International Journal of Infectious Diseases
Volume 12, Issue 6 , Pages e39-e47, November 2008

Saposin-like proteins are expressed in the gastrodermis of Schistosoma mansoni and are immunogenic in natural infections

  • Tegan A. Don

      Affiliations

    • Division of Infectious Diseases and Immunology, Queensland Institute of Medical Research, 300 Herston Rd, Brisbane 4006, Queensland, Australia
    • School of Molecular and Microbial Sciences, The University of Queensland, Brisbane, Queensland, Australia
    • ,
  • Jeffrey M. Bethony

      Affiliations

    • Department of Microbiology, Immunology and Tropical Medicine, George Washington University, Washington DC, USA
    • ,
  • Alex Loukas

      Affiliations

    • Division of Infectious Diseases and Immunology, Queensland Institute of Medical Research, 300 Herston Rd, Brisbane 4006, Queensland, Australia
    • Corresponding Author InformationCorresponding author. Tel.: +61 7 3845 3702; fax: +61 7 3845 3507.

Received 12 October 2007; received in revised form 30 October 2007; accepted 30 October 2007. published online 24 June 2008.

Corresponding Editor: Sunit K. Singh, Hyderabad, India

Article Outline

Summary 

Background

Schistosomes are parasitic blood flukes that inhabit the portal blood system of humans. Ingested red cells are lysed in the gastrodermis to enable the parasites to digest hemoglobin. Saposin-like proteins (SAPLIPs) have been reported from the gastrodermis of related flukes, and at least one is hemolytic and a promising vaccine antigen. We now provide the first report of SAPLIPs from schistosomes and explore their role in host–parasite interactions.

Methods

We identified expressed sequence tags encoding a family of SAPLIPs from Schistosoma mansoni and produced one (termed Sm-SLP-1) in recombinant form using baculovirus. The anatomic site of SLP-1 expression within the worm was assessed and its recognition by sera from chronically infected humans and mice was determined. The vaccine efficacy of Sm-SLP-1 was tested in a mouse model.

Results

Full-length sequences were obtained for two cDNAs, Sm-slp-1 and Sm-slp-2. The Sm-slp-1 open reading frame contained a single SAPLIP domain while Sm-slp-2 had a double domain. Sm-SLP-1 was immunolocalized to the gastrodermis of adult worms, but did not confer protection in a murine vaccination model of schistosomiasis. Mice infected with S. mansoni generated a specific antibody response to Sm-SLP-1. Individuals who were infected with S. mansoni had IgG that recognized Sm-SLP-1. IgG levels were statistically higher in individuals with heavy infection.

Conclusions

Sm-SLP-1 is expressed in the gastrodermis of S. mansoni. It is immunogenic in humans and mice, but is not protective as a vaccine in its current form. Schistosome SAPLIPs warrant further attention to elucidate their roles in host–parasite interactions and to further explore their potential as vaccine and diagnostic antigens.

Keywords: Schistosoma, Helminth, Saposin, SAPLIP, Vaccine, Gastrodermis

 

Back to Article Outline

Introduction 

Human schistosomes infect more than 200million people worldwide with at least 600million more at risk of infection,1 making them a leading cause of parasite-induced morbidity. The World Health Organization (WHO) estimate of 0.5% disability weight assigned to schistosomiasis was recently revised by King et al. to 2–15%.2 There are three major species of human medical significance, Schistosoma haematobium, Schistosoma japonicum, and Schistosoma mansoni.

Schistosomes are exclusive blood feeders, and it is estimated that female S. mansoni parasites can ingest approximately 330000 erythrocytes per hour.3 The hemoglobin (Hb) degradation pathway in schistosomes has been partially elucidated,4, 5 however the step immediately preceding this, hemolysis, has received far less attention. Erythrocytes ingested by schistosomes are thought to be lysed by the action of a hemolysin(s) within the esophagus and intestine,6, 7 which is proposed to form pores in the erythrocyte membrane.8 Hemolysins may play additional roles in the parasite – egg extracts of S. japonicum contain lytic molecules that are thought to aid their movement through the tissues and into the gut lumen for excretion.9 Despite these earlier studies, molecule(s) involved in hemolysis and general pore formation have yet to be characterized in any detail from schistosomes.

Recently, lytic proteins were identified from two liver fluke species: clonorin from Clonorchis sinensis10 and FhSAP1 and FhSAP2 from Fasciola hepatica.11 The proteins share sequence homology to amoebapores, pore-forming peptides from Entamoeba histolytica,12 and belong to the saposin-like protein (SAPLIP) family of distantly related polypeptides that have six conserved cysteine residues forming three disulfide bridges.13, 14, 15, 16 SAPLIPs are found in all animals ranging from protozoa to mammals, and where known, their function seems to involve interactions with lipids. Clonorin, from C. sinensis, is expressed exclusively in the gut of adult flukes10 and was proposed to lyse ingested host cells for nutritional purposes. FhSAP2 of F. hepatica is found in the excretory/secretory (ES) products, which act externally of the parasite,11 and although it has not been localized to a defined tissue within the parasite, this protein might also be involved in feeding. Recombinant FhSAP2 is partially protective in vaccine trials using rabbits,11 indicating that helminth pore-forming proteins might be potential vaccine candidates.

Here we describe the identification and characterization of two cDNAs encoding SAPLIPs from S. mansoni, Sm-slp-1 and Sm-slp-2. The SLP-1 protein is expressed in the gastrodermis of the parasite and is recognized by antibodies from infected mice and human subjects, but does not appear to be an efficacious vaccine antigen in a murine model of S. mansoni in its current form.

Back to Article Outline

Materials and methods 

Sequence identification, cDNA library PCR, and sequence analysis 

Clonorin, the saposin-like protein from the liver fluke C. sinensis, was used to search GenBank (nr) and dbEST datasets by BLAST search (http://www.ncbi.nlm.nih.gov/BLAST/).17 An S. japonicum expressed sequence tag (EST) was identified and subsequently used to identify homologous sequences from S. mansoni. cDNA and predicted protein sequences were analyzed using MacVector version 7.2., and predicted signal peptides were assessed using SignalP (http://www.cbs.dtu.dk/services/SignalP/).18 Where ESTs did not encode full-length cDNA sequences (Sm-slp-2), the 5′ and 3′ termini were obtained by PCR using a combination of gene-specific oligonucleotide primers designed from the EST sequences and vector-derived primers that flanked the cloning site of an S. mansoni adult worm cDNA library constructed in λZAP-CMV (Stratagene). Primers used were as follows: Sm2F (5′ TCGTCCACTCGAAACTCCGGA) to find the 3′ end and Sm2GCR (5′ CTCCGGAGTTTCGAGTGGACG) to find the 5′ end. Multiple sequence alignments were assembled with ClustalW using the amino acid sequences between the first and sixth cysteine residues of each individual SAPLIP domain.

Expression and purification of recombinant proteins in baculovirus 

Recombinant proteins were expressed in a baculovirus shuttle plasmid (pMelBac, Invitrogen) fused to an N-terminal melittin signal peptide. Primers incorporating a six-residue GC-rich clamp followed by restriction sites for Sac I (5′) and Nco I (3′) were designed to span the entire open reading frames (ORFs) of Sm-SLP-1 and Sm-SLP-2 without their predicted signal peptides. 3′ Primers contained sequence encoding a 6×His tag and stop codon for downstream purification using metal ion affinity chromatography. The following primer sequences were used for SLP-1: Sm1pmbF (5′ GCGCGCGAGCTCTACTCTGTCAAGAATGTGGAT); Sm1pmbR (5′ GCGCGCCCATGGTTAATGGTGATGGTGATGATGACATAAAGGAGTCAATTTGCA); and for SLP-2: Sm2pmbF (5′ GCGCGCGAGCTCAACAAAATTAATTTACTTACTAAG); Sm2pmbR (5′ GCGCGCCCATGGTTAATGGTGATGGTGATGATGGTAGAGGATAAGTTTGAAAAG). Expression and purification of recombinant proteins in both pMelBac and in a modified pMelBac plasmid, termed pHotWax, were as previously published.19 Removal of C-terminal purification tags (V5 and His epitopes) from recombinant proteins expressed in pHotWax was performed using AcTEV Protease (Invitrogen) according to the manufacturer's instructions. To assess the ability of recombinant proteins to dimerize, Western blots of both native (samples were not boiled or reduced) and reduced/denatured Sm-SLP-1, as well as adult schistosome extracts (SmTX)20 were probed with Sm-SLP-1-specific antiserum. Hemolysis assays using recombinant SLPs were conducted as described previously.21

Antibody production and immunolocalization 

Antisera against recombinant Sm-SLP-1 (expressed in pMelBac) formulated with Freund's complete (first immunization) and incomplete (second and third immunizations) adjuvants were raised in female CBA/CaH mice as previously described.22 Immunolocalization using fluorescence microscopy was performed on paraformaldehyde-fixed adult worm sections of S. mansoni as published elsewhere.22 All animal research was approved by the Animal Ethics Committee of the Queensland Institute of Medical Research.

Vaccine efficacy 

A group of 10 female CBA/CaH mice were vaccinated with 25μg Sm-SLP-1 emulsified in Freund's complete adjuvant as described above. A group of control mice were immunized with phosphate-buffered saline (PBS)/adjuvant. The rest of the vaccine trial including immunization regimen, parasite challenge, necropsy of mice, and assessment of parasite burdens (adult worms and eggs in liver) were performed as described elsewhere by us.22

Detection of mouse and human anti-SLP-1 antibody responses 

Indirect ELISA was used to determine whether recombinant Sm-SLP-1 was recognized by serum antibodies from vaccinated and control mice before and after parasite challenge, and humans living in the schistosomiasis endemic areas of Minas Gerais state, Brazil. Microtiter plates were coated overnight at 4°C with 0.5μg recombinant Sm-SLP-1 per well or 0.5μg of S. mansoni adult worm extract solubilized in 1% Triton X-100 in PBS (SmTX). Both proteins were diluted to 5μg/ml in coating buffer (0.06M NaCO3, pH 9.6) and applied to microtiter plates (100μl/well). For human studies, assembly of cohorts and ELISA methods were as previously described using the Sm-TSP-2 recombinant protein22 except that human sera were diluted 1:5000.

The ethical review board of George Washington University, the ethical committee of Centro de Pesquisas Rene Rachou (FIOCRUZ), and the Federal Brazilian Ethical Review Board (CONEP) reviewed and approved the study of chronically infected individuals (egg-positive and egg-negative) from endemic areas in Minas Gerais state, Brazil. The ethical review board of the Centro de Pesquisas Rene Rachou (FIOCRUZ) reviewed and approved the study of non-endemic egg-negative controls and putatively resistant individuals.

A one-way analysis of variance (ANOVA) procedure was used with IgG levels to Sm-SLP-1 as the quantitative dependent variable and with the following categories: (1) non-endemic negative control, (2) putative resistant, (3) egg-negative (resident in endemic area), (4) light infection (1–99 eggs per gram (epg)), (5) moderate infection (100–399epg ), and (6) heavy infection (≥399epg). Analysis of variance was used to test the hypothesis that the means among these groups were equal. Once a difference had been determined to exist among the means between groups, a Bonferroni post-hoc test (for pairwise multiple comparisons) was used to determine which means differ between pairs of groups, yielding a matrix, which indicated significantly different group means at an alpha level of 0.05.

For ELISAs with mouse sera, wells were washed three times in phosphate-buffered saline plus 0.05% Tween 20 (PBST) , blocked for 1hour at 37°C with 2% bovine serum albumin (BSA) /PBST and washed again three times in PBST. Sera were titrated using doubling dilutions from 1:100 to 1:204800. Plates were incubated for 1 hour at 37°C, washed three times in PBST then reacted with anti-mouse Ig-horseradish peroxidase (HRP) diluted 1:5000 in PBST for 1 hour at 37°C. After three final washes in PBST, wells were incubated with 2,2′-azino-bis(3-ethylbenzthiazoline-6-sulfonic acid) (ABTS) (Chemicon) substrate for 30min. Absorbance was measured colorimetrically in an automated plate reader (BioRad) at 405nm.

Back to Article Outline

Results 

cDNAs encoding schistosome SAPLIPs 

Using the predicted protein sequence of clonorin from C. sinensis as the query, a tBLASTn search of the Schistosoma ESTs was undertaken. One of the homologues identified from S. japonicum (EST BU712004) encoded a full-length predicted protein with a signal peptide and a single SAPLIP domain. The predicted ORF of BU712004 was then used to perform a BLASTp search of the S. mansoni translated amino acid contigs at http://bioinfo.iq.usp.br/schisto6/. Eight distinct contigs with greater than 18% identity over at least 50 amino acids were identified (Figure 1). Two of these contigs were selected for further analysis: (1) EST AF521090 corresponded to clone p33F5, a cDNA expressed in adult and larval stages that our group had already identified using a signal sequence trapping technique;23 however, due to the low identities between SAPLIP family members, p33F5 was initially classed as having no homologues of known function. (2) EST AI977047 contained part of an N-terminal signal peptide (missing the initiator methionine) that obtained a positive score on signalP (http://www.cbs.dtu.dk/services/SignalP/) followed by one full length SAPLIP domain and a partial second SAPLIP domain (containing the first four cysteines).

  • View full-size image.
  • Figure 1. 

    Multiple sequence alignment of translated Schistosoma expressed sequence tags (ESTs), which belong to the saposin-like protein (SAPLIP) family. AF521090 corresponds to Sm-SLP-1 and AI977047 corresponds to Sm-SLP-2 before full-length sequence was obtained. GenBank accession numbers are listed following schistosome species: Sm, Schistosoma mansoni; Sj, Schistosoma japonicum (exceptions are Sm01689 which is GeneDB ID and C605193.1 which is a contig ID). D1 and D2 refer to SAPLIP domains 1 and 2 of AI977047, respectively. The conserved cysteine residues are boxed in gray and the histidine thought to be involved in dimerization is shaded pink. Conserved tyrosines found in saposins are shaded in blue. Gaps have been introduced to maximize amino acid alignments.

Using PCR with gene-specific primers and cDNA library as template, the 5′ and 3′ ends of Sm-SLP-2 were identified, and confirmed that this mRNA encoded a protein with two SAPLIP domains (Figure 2A). Sm-SLP-1 ORF comprised 114 amino acids (including a signal peptide of 18 residues) with a predicted molecular mass of 11524.31Da and pI of 7.00. Sm-SLP-2 had an ORF of 213 amino acids (including a signal peptide of 21 residues and two SAPLIP domains) with a predicted molecular mass of 21794.18Da and pI of 6.08. The single SAPLIP domain from Sm-SLP-1 and both SAPLIP domains from Sm-SLP-2 possessed the general primary sequence features of the SAPLIP family of lipid-interacting proteins,16 including the positioning of the six cysteine residues involved in disulfide bond formation and the general number and positioning of hydrophobic residues (Figure 2B). The conserved tyrosine found in saposins between helices 3 and 4 is present in Sm-SLP-1 and both SAPLIP domains of SLP-2. Neither Sm-SLP-1 nor SLP-2 contained the His at the end of helix 5 that is responsible for dimerization of amoebapores.24 Only one of the SAPLIP-like ORFs encoded by the S. mansoni ESTs contained a histidine in this position (Figure 1).

  • View full-size image.
  • Figure 2. 

    Comparison of Schistosoma mansoni SLP-1 and SLP-2 predicted proteins with other members of the saposin-like (SAPLIP) family of proteins. (A) Schematic representation of the general architecture of members of the SAPLIP family. Features highlighted include signal peptides (SP), the six-cysteine containing domain, and predicted N-glycosylation sites (N). (B) Multiple sequence alignment of Sm-SLP-1 and SLP-2 with other SAPLIPs using the SAPLIP domain between the first and sixth cysteines only. Sj_BU712004, Schistosoma japonicum (GenBank accession number BU712004); EhA, Entamoeba histolytica amoebapore A (M83945); EhB, E. histolytica amoebapore B (CAA54226); Ac-PFP-1 (Ac-SLP-1), Ancylostoma caninum saposin-like protein (DQ855414); Ce_spp4, Caenorhabditis elegans SAPLIP protein family 4 (AAA81416); Sap_A_slimemould, Dictyostelium discoideum saposin A (BAA32237); Sap_B_human, Homo sapiens saposin B (NP_001035930); Sap_C_bovine, Bos taurus saposin C (P26779); SPB_human, H. sapiens pulmonary surfactant B (P07988); clonorin, Clonorchis sinensis clonorin (AF421960); FhSAP2, Fasciola hepatica SAP2 (AF286903); NK_Lysin, Sus scrofa NK-lysin (CAA59720); Aoah_human, H. sapiens acyloxyacyl hydrolase (BAD97196); countin, D. discoideum AX4 countin (XP_643887); Ce_ZK455.4, C. elegans hypothetical protein (CAA91493); Asm_human, H. sapiens acid sphingomyelin phosphodiesterase 1 (BAD93012). The six conserved cysteine residues are boxed in gray with predicted disulfide bonding patterns shown underneath (1–6, 2–5, 3–4). Hydrophobic residues are boxed in blue; yellow denotes conserved proline in saposins or alanine in SAPLIPs and green highlights the conserved tyrosine (or phenylalanine) in saposins. The histidine predicted to be involved in dimerization of amoebapores is shaded in pink. Predicted alpha-helices of amoebapore A are shown as solid lines above the alignment, and putative N-linked glycosylation sites are shown in bold font. Gaps have been introduced to maximize the alignment.

Expression of recombinant SAPLIPs in insect cells 

Recombinant Sm-SLP-1 was secreted by Sf-9 and Hi5 cells that were infected with recombinant baculovirus carrying Sm-SLP-1 cDNA in either pMelBac (rSLP-1) or pHotWax (rSLP-1–pHW). Recombinant proteins were purified via the 6×His tag under native conditions using Ni-NTA (nickel-nitrilotriacetic acid) affinity chromatography (Figure 3A) and both were detected by Western blot using homologous mouse antiserum (Figure 3B). The yields of purified recombinant proteins were approximately 0.6mg/l for rSLP-1 and approximately 0.1mg/l for rSLP-1–pHW. The expression yield of Sm-SLP-2 in pMelBac was only detectable by Western blotting after extensive concentration of supernatant, and was therefore considered too low to pursue (data not shown). We did not attempt to express Sm-SLP-2 in the pHotWax vector.

  • View full-size image.
  • Figure 3. 

    Expression and purification of recombinant Sm-SLP-1 (rSLP-1) proteins in different expression vectors recombined with baculovirus. (A) Coomassie Brilliant Blue-stained SDS-PAGE gel of purified recombinant Sm-SLP-1 highlighting the size difference due to the different C-terminal purification tags. Lane 1, rSLP-1; lane 2, rSLP-1–pHW. (B) Western blots showing recognition of recombinant proteins by homologous mouse antiserum. Lanes 1 and 3, rSLP-1; lanes 2 and 4, rSLP-1–pHW. Lanes 1–2 probed with normal mouse serum; lanes 3–4 probed with mouse anti-Sm-SLP-1. Molecular weight markers are shown in kDa on the left.

Recombinant SLP-1 is not hemolytic 

Recombinant SLP-1 (containing the C-terminal purification tags) was not functionally active in hemolysis assays (data not shown), and dimer formation was not detected when the recombinant protein was electrophoresed on native-polyacrylamide gel electrophoresis (PAGE) gels under non-reducing conditions (data not shown). Recombinant SLP-1–pHW was not hemolytic and did not form dimers on native-PAGE gels (data not shown). Extensive attempts to cleave the C-terminal purification tags from rSLP-1–pHW using tobacco etch virus (TEV) protease were unsuccessful, indicating that the C-terminus might have been inaccessible to TEV protease due to the fold of the recombinant proteins.19

Sm-SLP-1 is expressed in the gastrodermis of adult worms and is recognized by sera from infected mice 

Antibodies to rSLP-1 were used to localize the native protein to the gastrodermis of both male and female adult S. mansoni by immunofluorescence (Figure 4). Pre-vaccination mouse serum did not bind to any structures. Antiserum to rSLP-1 was used to probe adult schistosome extracts solubilized in 1% Triton X-100 in PBS (SmTX) electrophoresed under denaturing and non-denaturing conditions (to address dimerization of native SLPs), but bands were not detected by either method (data not shown). The antiserum did, however, detect proteins in immunohistochemistry, perhaps reflecting differential accessibility of epitopes when the proteins are electrophoresed in a polyacrylamide gel compared with parasite tissue sections. In addition, mouse antiserum to rSLP-1 detected a protein in SmTX by ELISA, indicating that antibodies to the recombinant product were able to detect the native Sm-SLP-1 protein in a complex extract. Although titers were low (1:800 from pooled serum – see next section), Sm-SLP-1 would represent only a very minor component of SmTX.

  • View full-size image.
  • Figure 4. 

    Immunostaining of adult mixed sex Schistosoma mansoni sections with mouse anti-Sm-SLP1 serum followed by anti-mouse-Cy3 (red fluorescence) in all panels and DAPI (blue fluorescence to visualize nuclei) in panels A and B only. All images are shown with corresponding bright field images on the left and fluorescent images on the right. Boxed regions are magnified on the far right of each panel. (A) Section of a male worm probed with pre-immune serum (NMS). (B) Section of two male worms probed with anti-Sm-SLP-1 serum. (C) Section of paired male and female worms probed with anti-Sm-SLP-1 serum. Native Sm-SLP-1 was localized to the gastrodermis (gas) of both male and female adult worms.

Sm-SLP-1 is a poor vaccine candidate in its current form 

Vaccination of CBA/CaH mice with rSLP-1 using a previously established vaccination protocol that conferred protection with other recombinant antigens22 did not result in a reduction in worm or egg burdens in vaccinated animals when compared to controls (Table 1). Despite the presence of antibody titers in excess of 1:100000 against the recombinant immunogen, adult worm and egg burdens recovered from vaccinated mice were actually higher (but not statistically significant) than those from control animals. Moreover, and as highlighted earlier, mouse antibodies to rSLP-1 recognized the native protein in the gastrodermis of adult worms and in a complex parasite extract by ELISA. Sera from vaccinated and control mice strongly recognized rSLP-1 after parasite challenge (titers of 1:12800 in control mice – Table 1), indicating that the protein is immunogenic during the course of a natural murine infection with S. mansoni.

Table 1. Vaccination of mice with recombinant Sm-SLP-1 does not protect against challenge infection with Schistosoma mansoni
ImmunogenAbsolute endpoint titers to rSLP-1Absolute endpoint titers to SmTXNo. adult wormsNo. female wormsNo. male wormsNo. eggs in liverLiver weight (g)
Pre-challengePost-challengePre-challengePost-challenge
PBS+adjuvantND1:128001:2001:320042±621±322±329073±41992.448±0.131
rSLP-1+adjuvant1:1024001:512001:8001:320057±428±229±248560±26872.829±0.071

PBS, phosphate-buffered saline; ND, not determined.

Recombinant Sm-SLP-1 is recognized by antibodies from infected people 

Recombinant SLP-1 was recognized by IgG from people living in an area of high schistosomiasis transmission in the endemic area of Melquiades, Brazil (Figure 5A). Stratification by WHO class of infection25 showed that moderately (100–399epg) and heavily (≥399 epg ) infected individuals had significantly higher levels of IgG than lightly infected (1–99epg) and egg-negative individuals from the same endemic area (p=0.029). The IgG levels to rSLP-1 between moderately and heavily infected individuals did not differ significantly from each other. Furthermore, residents of the endemic area who did not have eggs in their feces – either putative resistant (PR)22 or egg-negative individuals – had higher IgG levels than individuals who were not resident in the endemic area of Melquiades (non-endemic controls) (p=0.04 – not shown). Egg-positive individuals had a significantly higher level of IgG against rSLP-1 than PR individuals (p=0.025) and individuals were egg-negative for other reasons (p=0.025) from the same endemic area (not shown). The increase and then plateau of IgG levels of individuals with moderate to high levels of infection suggests that a ‘threshold effect’ of IgG is reached based upon the intensity of infection.

  • View full-size image.
  • Figure 5. 

    (A) The relationship between classes of infection intensity of Schistosoma mansoni and mean IgG against recombinant Sm-SLP-1. Bars represent standard error of the mean; epg, eggs per gram of feces. Classes of infection intensity are set forth by Montresor et al.25 PR=putative resistant (see reference 22). (B) The relationship between infection status of endemic-negative, endemic-positive, and PR individuals and IgG reactivity to recombinant Sm-SLP-1 and crude schistosome adult worm (SmTX) and egg (SEA) antigens. The endemic-positive group was generated from a pool of the three groups of infected people (light, moderate, and heavy) shown in panel A. Bars represent standard errors of the mean.

IgG responses to rSLP-1 showed similar distribution to those against SmTX and SEA (schistosome egg antigen) (Figure 5B); IgG levels to both crude antigen extracts and rSLP-1 were elevated in egg-positive individuals. Though statistically significant (p=0.01), only moderate correlations of 0.383 for SmTX and rSLP-1 and 0.334 for SEA and rSLP-1 were found, indicating that while IgG levels were elevated against these three antigens in infected individuals, absolute levels of IgG to each differed. The correlation of IgG levels between SmTX and SEA in infected individuals was 0.845 (p=0.01).

Sera from patients resident in Melquiades who were mono-infected with hookworm (n=5), Ascaris (n=5), Leishmania (n=5), and Toxoplasma, all prevalent in this region of Brazil, did not have detectable antibody responses to rSLP-1 (not shown).

Back to Article Outline

Discussion 

Here we describe the cloning and expression of two S. mansoni cDNAs encoding SAPLIPs, localization of one of the proteins (SLP-1) to the gastrodermis of adult worms, and serologic recognition of SLP-1 by infected humans and animals. Sm-SLP-1 and SLP-2 conform to the characteristics of the SAPLIP family, specifically the presence of six cysteine residues (which are predicted to form three disulfide bonds) and the distribution of conserved hydrophobic residues.16 The disulfide bonds and predicted structure, which is based on amoebapore A,26 confers remarkable stability to the proteins.10, 13, 27 Due to the low sequence homology between SAPLIPs other than those shared residues described above, it is difficult to hypothesize specific functions on sequence alone, but as SAPLIPs in general interact with lipids on cell membranes,13, 16 these schistosome SAPLIPs in the gastrodermis might well interact with lipids on the surface of ingested host cells.

Dimerization is a common feature of many SAPLIPs, but occurs via different mechanisms in different proteins.16 Some SAPLIPs dimerize via an intermolecular disulfide bond, while others rely on electrostatic interactions. Amoebapore A uses a head-to-tail mechanism via a C-terminal histidine.24 Although some helminth SAPLIPs do possess C-terminal histidines that are potentially involved in dimerization,10, 19 neither Sm-SLP-1 nor either SAPLIP domain of Sm-SLP-2 have an equivalent C-terminal histidine. However, a single S. mansoni EST encoding a SAPLIP domain (Q26536) did contain a C-terminal histidine (Figure 1), suggesting that this protein might form dimers in a similar manner to amoebapore A. Human saposin isoforms (A–D) share little sequence identity other than a strictly conserved tyrosine and proline, and the tyrosine located in the loop between helices 3 and 4 (between the fourth and fifth cysteines) was also conserved in Sm-SLP-1 and SLP-2, suggesting that these two proteins (and other predicted S. mansoni proteins – Figure 1) are more similar to saposins than to other sub-families of SAPLIPs.

No hemolytic activity was identified in rSLP-1, but this may be due to the presence of the purification tags at the C-terminus, which could be interfering with potential dimerization or proper folding of the recombinant protein. Similarly, clonorin from C. sinensis was only able to lyse erythrocytes after removal of its C-terminal purification tag,10 so we expressed rSLP-1–pHW with a potentially cleavable C-terminus. Even after numerous attempts, no cleavage was seen at the TEV site, possibly due to the inability of the protease to interact with the cleavage site due to steric occlusion by ordered structures in the recombinant protein (http://mcl1.ncifcrf.gov/waugh_tech/faq/tev.pdf). To combat this problem, addition of extra residues between the cleavage site and recombinant protein may allow TEV to cleave more efficiently. However, this would have defeated the purpose of expressing rSLP-1 with a cleavable tag to allow potential head-to-tail dimerization.

Sm-SLP-1 is expressed in the gastrodermis of adult schistosomes and could therefore be involved in lysis of ingested red cells, similar to the predicted role of C. sinensis clonorin10 and Fasciola gigantica SAPLIPs,28 which are also localized in the gastrodermis. However, production of active recombinant Sm-SLP-1 and SLP-2, or silencing of the respective mRNAs is needed to better understand their biological functions and confirm a role in hemolysis. Other potential roles of a gastrodermal SAPLIP might include acquisition and transport across the gastrodermal cells of host lipids from serum as a source of nutrition.29

Rabbits vaccinated with rFhSAP2 are protected against F. hepatica challenge infection,30 suggesting that SAPLIPs are efficacious vaccine antigens against trematode parasites. Even though rSLP-1 is immunogenic in natural infections and upon immunization with recombinant, adjuvant protein, it offers no protection against parasite challenge under the conditions assessed here. One cannot completely discount the potential of this protein as a vaccine. Its poor efficacy in this study might reflect incorrect folding/multimerization, thus not presenting epitopes that might be protective. Moreover, the mRNA for Sm-slp-1is expressed in larval schistosomes as well as adult worms,23 suggesting that it is also accessible as a target during the early stages of infection in the mammalian host.

Sm-SLP-1 was not recognized by individuals who resided outside an area of active S. mansoni transmission. However, rSLP-1 was recognized by all three categories of individuals resident in an area of active S. mansoni transmission:22 (1) putative resistant (PR), (2) egg-negative, and (3) egg-positive individuals. There were statistically significant differences in the IgG levels to rSLP-1 among these groups from the endemic area, with putative resistant and egg-negative individuals having significantly lower levels of IgG to rSLP-1 than individuals who were egg-positive. The lower levels of IgG in the egg-negative group (but higher than that of the non-endemic controls) could be attributed to several factors, including previous infection, which resolved by changes in water contact behavior, or by treatment with praziquantel. The lower levels of IgG in putative resistants might reflect a lack of exposure to SLP-1, because these individuals are usually egg-negative and their immune response is thought to kill the parasite before it reaches maturity and consumes large amounts of blood. Schistosomes have a blind gut and regurgitate as they feed, providing a likely mechanism by which a protein in the gastrodermis, such as SLP-1, is released into the blood stream. Sm-slp-1 mRNA is expressed in cercariae as well as adult worms,23 suggesting that the juvenile parasites might also release SLP-1 into the host environment.

Individuals with an active infection (egg-positive) had significantly higher levels of IgG to rSLP-1 than did egg-negative individuals. Further analyses, stratified by infection intensity as defined by the WHO, showed that individuals with moderate or heavy infection had a significantly higher level of IgG against rSLP-1 in contrast to individuals with a lower level of infection intensity, regardless of age and sex (data not shown). The increase and then plateau of anti-SLP-1 IgG among individuals with moderate to high levels of schistosome infection suggests a ‘threshold effect’ in which a certain level of IgG is reached based upon the intensity of infection. Future work should address the relationship between antibody levels to SLP-1 and schistosomiasis infection intensity, including further characterization of the humoral (isotype and IgG subclass) and cellular responses to this antigen.

Back to Article Outline

Acknowledgments 

We thank Mary Duke, Mai Tran, Mark Pearson, Michael Smout, and Danielle Smyth for helpful discussions and provision of reagents. We thank Simone Mansur for technical assistance. We are particularly grateful to Rodrigo Correa de Oliveira (Centro de Pesquisas René Rachou (FIOCRUZ), Belo Horitone, Brazil) for provision of non-endemic control sera and putative immune sera. We also thank Peter O’Donoghue for advice and support. T.A.D. was supported by an Australian Postgraduate Award and by the Queensland Institute of Medical Research (QIMR). A.L. was supported by a Senior Research Fellowship from the National Health and Medical Research Council of Australia (NHMRC). This research was funded by NHMRC. NHMRC did not play a role in study design, in the collection, analysis and interpretation of data, in the writing of the manuscript, and in the decision to submit the manuscript for publication.

Ethical approval: All animal research was approved by the Animal Ethics Committee of the Queensland Institute of Medical Research. The ethical review board of George Washington University, the ethical committee of Centro de Pesquisas Rene Rachou (FIOCRUZ), and the Federal Brazilian Ethical Review Board (CONEP) reviewed and approved the study of chronically infected individuals (egg-positive and egg-negative) from endemic areas in Minas Gerais state, Brazil. The ethical review board of the Centro de Pesquisas Rene Rachou (FIOCRUZ) reviewed and approved the study of non-endemic egg-negative controls and putatively resistant individuals.

Conflict of interest: No conflict of interest to declare.

Back to Article Outline

References 

  1. Crompton DW. How much human helminthiasis is there in the world?. J Parasitol. 1999;85:397–403
  2. King CH, Dickman K, Tisch DJ. Reassessment of the cost of chronic helmintic infection: a meta-analysis of disability-related outcomes in endemic schistosomiasis. Lancet. 2005;365:1561–1569
  3. Lawrence JD. The ingestion of red blood cells by Schistosoma mansoni. J Parasitol. 1973;59:60–63
  4. Brindley PJ, Kalinna BH, Dalton JP, Day SR, Wong JY, Smythe ML, et al. Proteolytic degradation of host hemoglobin by schistosomes. Mol Biochem Parasitol. 1997;89:1–9
  5. Caffrey CR, McKerrow JH, Salter JP, Sajid M. Blood ‘n’ guts: an update on schistosome digestive peptidases. Trends Parasitol. 2004;20:241–248
  6. Kasschau MR, Robinson DC, Dresden MH. Schistosoma mansoni: activation of hemolytic activity in homogenates from live adult worms. Exp Parasitol. 1986;62:442–449
  7. Kasschau MR, Dresden MH. Schistosoma mansoni: characterization of hemolytic activity from adult worms. Exp Parasitol. 1986;61:201–209
  8. Kasschau MR, Byam-Smith MP, Gentry DS, Watson FN. Influence of pH and temperature on hemolysis by adult Schistosoma mansoni membranes. J Exp Zool. 1995;271:315–322
  9. Asahi H, Moribayashi A, Sendo F, Kobayakawa T. Hemolytic factors in Schistosoma japonicum eggs. Infect Immun. 1984;46:514–518
  10. Lee JY, Cho PY, Kim TY, Kang SY, Song KY, Hong SJ. Hemolytic activity and developmental expression of pore-forming peptide, clonorin. Biochem Biophys Res Commun. 2002;296:238–244
  11. Espino AM, Hillyer GV. Molecular cloning of a member of the Fasciola hepatica saposin-like protein family. J Parasitol. 2003;89:545–552
  12. Leippe M, Tannich E, Nickel R, van der Goot G, Pattus F, Horstmann RD, et al. Primary and secondary structure of the pore-forming peptide of pathogenic Entamoeba histolytica. EMBO J. 1992;11:3501–3506
  13. Zhai Y, Saier MH. The amoebapore superfamily. Biochim Biophys Acta. 2000;1469:87–99
  14. Leippe M, Andra J, Nickel R, Tannich E, Muller-Eberhard HJ. Amoebapores, a family of membranolytic peptides from cytoplasmic granules of Entamoeba histolytica: isolation, primary structure, and pore formation in bacterial cytoplasmic membranes. Mol Microbiol. 1994;14:895–904
  15. Andersson M, Gunne H, Agerberth B, Boman A, Bergman T, Sillard R, et al. NK-lysin, a novel effector peptide of cytotoxic T and NK cells. Structure and cDNA cloning of the porcine form, induction by interleukin 2, antibacterial and antitumour activity. EMBO J. 1995;14:1615–1625
  16. Bruhn H. A short guided tour through functional and structural features of saposin-like proteins. Biochem J. 2005;389:249–257
  17. Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ. Basic local alignment search tool. J Mol Biol. 1990;215:403–410
  18. Bendtsen JD, Nielsen H, von Heijne G, Brunak S. Improved prediction of signal peptides: SignalP 3.0. J Mol Biol. 2004;340:783–795
  19. Don TA, Oksov Y, Lustigman S, Loukas A. Saposin-like proteins from the intestine of the blood-feeding hookworm, Ancylostoma caninum. Parasitology. 2007;134(Pt 3):427–436
  20. Loukas A, Jones MK, King LT, Brindley PJ, McManus DP. Receptor for Fc on the surfaces of schistosomes. Infect Immun. 2001;69:3646–3651
  21. Don TA, Jones MK, Smyth D, O’Donoghue P, Hotez P, Loukas A. A pore-forming haemolysin from the hookworm, Ancylostoma caninum. Int J Parasitol. 2004;34:1029–1035
  22. Tran MH, Pearson MS, Bethony JM, Smyth DJ, Jones MK, Duke M, et al. Tetraspanins on the surface of Schistosoma mansoni are protective antigens against schistosomiasis. Nature Med. 2006;12:835–840
  23. Smyth D, McManus DP, Smout MJ, Laha T, Zhang W, Loukas A. Isolation of cDNAs encoding secreted and transmembrane proteins from Schistosoma mansoni by a signal sequence trap method. Infect Immun. 2003;71:2548–2554
  24. Andra J, Leippe M. Pore-forming peptide of Entamoeba histolytica. Significance of positively charged amino acid residues for its mode of action. FEBS Lett. 1994;354:97–102
  25. Montresor A, Crompton DW, Bundy DA, Hall A, Savioli L. Guidelines for the evaluation of soil-transmitted helminthiasis and schistosomiasis at community level: a guide for managers of control programs. Schistosomiasis and Intestinal Parasites Unit, Division of Control of Tropical Diseases (WHO/CTDS/SIP/98.1). Geneva, Switzerland: World Health Organization; 1998.
  26. Hecht O, Van Nuland NA, Schleinkofer K, Dingley AJ, Bruhn H, Leippe M, et al. Solution structure of the pore-forming protein of Entamoeba histolytica. J Biol Chem. 2004;279:17834–17841
  27. Kishimoto Y, Hiraiwa M, O’Brien JS. Saposins: structure, function, distribution, and molecular genetics. J Lipid Res. 1992;33:1255–1267
  28. Grams R, Adisakwattana P, Ritthisunthorn N, Eursitthichai V, Vichasri-Grams S, Viyanant V. The saposin-like proteins 1, 2, and 3 of Fasciola gigantica. Mol Biochem Parasitol. 2006;148:133–143
  29. Bennett MW, Caulfield JP. Specific binding of human low-density lipoprotein to the surface of schistosomula of Schistosoma mansoni and ingestion by the parasite. Am J Pathol. 1991;138:1173–1182
  30. Espino AM, Hillyer GV. A novel Fasciola hepatica saposin-like recombinant protein with immunoprophylactic potential. J Parasitol. 2004;90:876–879

PII: S1201-9712(08)00105-7

doi:10.1016/j.ijid.2007.10.007

International Journal of Infectious Diseases
Volume 12, Issue 6 , Pages e39-e47, November 2008

Article Tools

* Image Usage & Resolution