Volume 13, Issue 6 , Pages e450-e455, November 2009
Detection of virulence genes in Staphylococcus aureus isolated from paper currency
Article Outline
Summary
Background
Infection with Staphylococcus aureus was initially considered a major problem in hospitals, but over the last few decades the incidence of community-acquired infection has also increased. Paper currency has recently been identified as another mode of spread by which community-acquired S. aureus infection may be transmitted, since paper currency is frequently transferred from one person to another. In the present study, S. aureus strains were isolated from paper currency and screened to detect virulence-associated genes.
Methods
Paper currency was collected randomly from operators in mutton shops, vegetable shops, hospitals, medical stores, snacks corners, and restaurants in the two cities of India, Dehradun and Delhi. Samples were screened for pathogenic S. aureus by various biochemical assays. Three isolates were used to study the survival of S. aureus on paper currency. Virulence genes were amplified by PCR. Antibiotic susceptibility was determined against nine antibiotics by the disk diffusion method.
Results
Sixty-seven isolates of Staphylococcus aureus were isolated from paper currency from the two Indian cities. The maximum number of isolates was recovered from hospitals, followed by mutton shops, and the minimum from restaurants. The test isolates could survive on paper currency for eight days under in vitro conditions (27
°C temperature and 30% relative humidity). A set of four virulence genes viz. cna (16 isolates), icaA (19 isolates), hlg (21 isolates), and sdrE (18 isolates) was amplified using gene-specific primers. Only eight isolates possessed all four virulence genes. Antimicrobial susceptibility tests showed that those isolates having all the tested virulence genes were more resistant.
Conclusions
This study clearly suggests that paper currency can serve as a carrier for the spread of resistant bacterial pathogens.
Keywords: Staphylococcus aureus, Virulence genes, Pathogenicity, Spread
Introduction
The genus Staphylococcus includes several pathogenic organisms among which Staphylococcus aureus is one of the most important. Generally it is found on human skin and mucous membranes, however it can also be found in other areas of human contact including soil, water, and food products. The species is present as a short-term resident, short-lived contaminant, or long-term colony-forming organism and is capable of causing a wide variety of diseases, such as septicemia, sepsis, wound sepsis, septic arthritis, osteomyelitis, food poisoning, and toxic shock syndrome.1 Infection with S. aureus was initially considered a major problem in hospitals, but over the last few decades the incidence of community-acquired infection has also increased.2
The basis of pathogenicity depends on the number of virulence factors, including a variety of surface proteins that help in attachment and colonization of the bacteria within the cellular and extracellular material of the host, cellular proteins, protease, and toxins, which inhibit phagocytosis and interfere with the ability of the host to actively hinder infection by a specific immune response. Hemolysin and other enzymes aid the bacterial population in the invasion of the host tissue.3 Furthermore the accumulation of resistance factors has rendered the bacteria immune to a variety of commonly used antibiotics, thus increasing the ability of the bacteria to survive in hostile environments. The widespread occurrence of these strains could lead to outbreaks of staphylococcal infections in both the hospital and community. The mode of spread of S. aureus may be both conventional and/or non-conventional.4, 5, 6 The emergence of S. aureus strains that are resistant to numerous antibiotics including vancomycin indicates the possibility of returning to an era similar to that before the advent of antibiotics, when S. aureus was a major cause of nosocomial death.7
Paper currency has recently been identified as another mode of spread by which community-acquired S. aureus infection may be transmitted, since paper currency is frequently transferred from one person to another.4 However, not much is known about the virulence of the various strains recovered from environmental/non-conventional sources. To better evaluate the risk, it would be helpful to determine not only the total count of S. aureus from paper currency but also the virulence gene(s) that they possess. Hence, in the present study S. aureus strains were isolated from paper currency and were screened to detect virulence-associated genes with the use of gene-specific primers.
Materials and methods
Sample collection
Paper currency for the isolation of S. aureus was collected from different sources, including mutton shops, vegetable shops, hospitals, medical stores, snacks corners, and restaurants in the two cities of India, Dehradun and Delhi. This paper currency was collected randomly from operators at the above sampling points except hospitals. In the case of hospitals, samples were taken from staff and patient attendants. All the samples were brought to the laboratory separately in pre-sterilized polybags, and were processed immediately for the isolation of S. aureus.
Isolation and characterization of S. aureus
All paper currency samples were vortexed individually in a test tube containing 10
ml of 0.8% NaCl solution for 10
min. Serial dilutions were then prepared up to 10−10, and 100
μl from each test tube were spread on mannitol salt agar (MSA) medium plates. Plates were then incubated at 37
°C for 24–48
h to select the osmotolerant, mannitol-fermenting Staphylococcus. Gram staining was carried out for the isolates showing characteristic colonies on MSA medium. For further confirmation, suspected S. aureus isolates were grown on Baird–Parker and brain heart infusion agar plates, incubated at 37
°C for 24–48
h. The isolates were confirmed to be S. aureus by various biochemical assays, as per Bergey's manual of determinative bacteriology (data not shown).8
Screening for pathogenic S. aureus
Screening for pathogenic S. aureus was done by performing various biochemical assays, including the coagulase test, β-hemolysis, DNase test,9 and growth on S. aureus agar medium (Hi Media Pvt., Ltd).
Study of pathogen survival on paper currency
Three isolates of S. aureus – SA 4, SA 14, SA 25 – were selected for the study of pathogen survival, as these three isolates were positive in all four pathogenicity assays described above. To study the survival of the S. aureus isolates on paper currency, currency samples were soaked in S. aureus suspension (0.5 McFarland), in triplicate. The currency samples were then incubated at 37
°C for 24
h. After this the plates were incubated at room temperature (27
°C) and 30
±
3% relative humidity until completion of the experiment. A one-square inch area of the paper currency was cut and suspended in 1.0
ml of 0.8% saline solution every following 24
h. This was serially diluted up to 10−8. One hundred microliters of each dilution was spread on an MSA plate in triplicate, and plates were incubated at 37
°C for 24
h. After incubation, plates were examined for the presence of S. aureus colonies, and colony-forming units (CFU)/ml was calculated.
DNA isolation
DNA isolation was done following the miniprep method.10 Isolated DNA samples were checked for purity and quantified by spectrophotometric analysis. The samples were then resolved on agarose gel (0.8%) with 1
μl of template DNA mixed with 3
μl of loading dye (xylene cyanol
+
bromophenol blue) and electrophoresed at 100 volts for 1
h. DNA samples showing intact bands were used for PCR amplifications.
PCR amplification of virulence genes
PCR amplifications of four virulence genes was done as described by Peacock et al.11 Specific primers (Table 1) were used to amplify the four virulence genes in all S. aureus isolates. To amplify the genes, 25
μl of reaction mixture was made containing 20 ng of template DNA, 100 ng of primers, 160
μM of dNTP mix, 1.25 U Taq polymerase, 1X Taq buffer, and 0.5
mM MgCl2. All 67 isolates were amplified individually for all four genes using the specific primers, with 32 cycles of denaturation at 95
°C for 1
min, annealing at 50
°C for icaA, 45
°C for sdrE, and 55
°C for hlg and cna for 1
min, extension at 72
°C for 1
min, and a final extension at 72
°C for 2
min, on a DNA engine (PTC-100, MJ Research, USA).
Table 1. Description of the primers used for the amplification of the different virulence-associated genes
| Gene | Primer sequence | Product length (bp) |
|---|---|---|
| cna (collagen adhesin) | F: 5′AGTGGTTACTAATACTG3′ | 744 |
| R: 3′CAGGATAGATTGGTTTA5′ | ||
| hlg (hemolysin) | F: 5′GCCAATCCGTTATTAGAAAATGC3′ | 937 |
| R: 3′CCATAGACGTAGCAACGGAT5′ | ||
| icaA (intracellular adhesin) | F: 5′GATTATGTAATGTGCTTGGA3′ | 770 |
| R: 3′ACTACTGCTGCGTTAATAAT5′ | ||
| sdrE (putative adhesin) | F: 5′AGTAAAATGTGTCAAAAGA3′ | 767 |
| R: 3′TTGACTACCAGGCTATATC5′ |
PCR products were resolved on 1.0% agarose gel at 60 volts for 2.5
h. Gels were stained with ethidium bromide solution (0.5
μg/ml) and documentation was done using the Gel Doc system (Bio-Rad).
Antibiotic susceptibility of S. aureus isolates
The antibiotic susceptibility of the test isolates was studied against nine different antibiotics using the disk diffusion method following the guidelines of the Clinical and Laboratory Standards Institute (CLSI). The susceptibility assay was performed on Mueller–Hinton agar plates using nine different antibiotics (Hi-Media Ltd), including penicillin (1 unit), methicillin (30
μg), ampicillin (10
μg), cefotaxime (30
μg), ciprofloxacin (5
μg), amikacin (30
μg), erythromycin (15
μg), clindamycin (2
μg), and vancomycin (30
μg). Quality control for susceptibility testing was done using S. aureus ATCC 25293.
Results
A total of 96 paper currency samples were used in this study. All the currency samples showed substantial numbers of bacterial colonies (38–270 per banknote) (Table 2). The total number of staphylococci on the MSA plates recovered from the currency samples ranged from 18 to 69 CFU per banknote. Further streaking of isolates on selective media yielded golden yellow colonies on MSA, pale-yellow on brain heart infusion medium, and black on Baird–Parker medium. From the above isolation method, a total of 67 isolates were maintained. These were confirmed to be S. aureus by performing various biochemical assays as per Bergey's manual of determinative bacteriology (data not shown).
Table 2. The various sampling sites in Dehradun and Delhi, and the total bacterial colony count and number of staphylococci
| Source | Dehradun | Delhi | ||||
|---|---|---|---|---|---|---|
| Total bacterial coloniesa | No. of S. aureusb | Frequencyc | Total bacterial coloniesa | No. of S. aureusb | Frequencyc | |
| Hospital | 270 | 16 | 28.07 | 218 | 14 | 21.87 |
| Mutton shop | 220 | 12 | 20.34 | 152 | 9 | 18.37 |
| Restaurant | 75 | 3 | 15.79 | 83 | 1 | 10.00 |
| Vegetable shop | 206 | 2 | 08.00 | 217 | 3 | 15.00 |
| Medical | 38 | 4 | 22.22 | 142 | 3 | 15.00 |
aAverage of the total number of colonies recovered from the total paper currency collected from each sampling source. |
bFigures represent the total number of isolates picked from the different currency sample and/or dilution plate. Isolates were confirmed by colony characteristics on selective media. |
cThe frequency of S. aureus was calculated as: (total number of S. aureus/total staphylococci) |
The pathogenicity of the isolates was evaluated using different tests and assays. Out of the 67 isolates, only eight were positive by the coagulase (tube) test and only seven isolates were shown to be positive by β-hemolysis on blood agar plates. Thirteen isolates showed DNase activity on DNase toluidine agar medium. The enzyme DNase is responsible for the degradation of host cell DNA. Out of 67 isolates of S. aureus only 16 were able to grow on S. aureus medium, showing as pale-yellow colonies. These biochemical assays performed for the characterization of S. aureus also revealed that the maximum number of pathogenic isolates was recovered from hospitals, followed by mutton shops, and the minimum from restaurants (Table 2).
The in vitro study of survival of S. aureus on paper currency revealed that all the three test isolates were able to survive for eight days at room temperature (Table 3). Though no colony was observed at any of the dilutions on day 8, the stock solution gave 5–8 colonies for all three test isolates. From day 9 onwards, no colony-forming units for any of the isolates was observed.
Table 3. Survival of Staphylococcus aureus on paper currency under in vitro conditions
| Isolates | Total CFUa after incubation period (days) | |||||||
|---|---|---|---|---|---|---|---|---|
| 1 | 2 | 3 | 4 | 5 | 6 | 7 | 8b | |
| SA 4 | TNC | 86 | 6.2 | 7.4 | 2.8 | 2.3 | 6.4 | 8 |
| SA 14 | TNC | 61 | 1.9 | 4.8 | 2.2 | 1.9 | 5.9 | 5 |
| SA 25 | TNC | 73 | 4.6 | 4.8 | 2.3 | 1.9 | 6.2 | 5 |
aThe average of the triplicate results; 100 |
bColonies appeared when 100 |
A set of four virulence genes was amplified using gene-specific primers (Table 4, Figure 1). Results revealed that all four genes were present in the isolates, but not all four in each isolate. Amplification of genomic DNA of all 67 S. aureus isolates for cna resulted in the amplification of a fragment of 744
bp in only 16 isolates; no amplification was found in the rest of the isolates. Among the 67 isolates, 21 showed amplification of a 937-bp fragment for hlg, while 19 isolates were recorded to carry the icaA gene and showed amplification of a 770-bp fragment with specific primers. Amplifications carried out for the availability of sdrE resulted in the amplification of a 767-bp fragment; this gene was available in only 18 of the 67 isolates. Though the amplification of all four genes was observed, this did not occur consistently in all of the isolates; different genes were available in different isolates. However, eight of the 67 isolates possessed all four virulence genes.
Table 4. The different virulence-associated genes found in the isolates
| Gene | Isolates possessing the specified gene |
|---|---|
| cna | SA 3, SA 4, SA 9, SA 11, SA 19, SA 24, SA 25, SA 33, SA 43, SA 45, SA 63, SA 65, SA 66, SA 69, SA 73, SA 74 (n |
| hlg | SA 4, SA 5, SA 6, SA 10, SA 13, SA 19, SA 25, SA 26, SA 30, SA 32, SA 33, SA 41, SA 42, SA 43, SA 45, SA 61, SA 63, SA 64, SA 65, SA 68, SA 69 (n |
| icaA | SA 4, SA 7, SA 9, SA 10, SA 11, SA 12, SA 19, SA 24, SA 25, SA 27, SA 33, SA 34, SA 43, SA 45, SA 54, SA 63, SA 65, SA 69, SA 74 (n |
| sdrE | SA 7, SA 9, SA 10, SA 19, SA 25, SA 33, SA 34, SA 43, SA 45, SA 52, SA 63, SA 64, SA 65, SA 68, SA 69, SA 70, SA 73, SA 74 (n |

Figure 1.
Amplification of the different target genes. A: amplified fragment (744
bp) of the cna gene; B: amplified fragment (937
bp) of the hlg gene; C: amplified fragment (770
bp) of the icaA gene; D: amplified fragment (767
bp) of the sdrE gene. Note the specific fragment with the red arrow. L denotes DNA ladder (100
bp
+
500
bp mix). *Each number corresponds to the S. aureus isolates as given in Table 4.
Antimicrobial susceptibility test results for the eight isolates having all four tested virulence genes showed more resistance in these isolates than those carrying fewer or none of the virulence genes (Table 5).
Table 5. Antimicrobial susceptibilities of virulence gene-positive and gene-negative isolates of S. aureus from paper currency
| Antimicrobial agents | S. aureus isolates carrying all four resistance genes (% resistanta) (n | S. aureus isolates carrying ≤3 resistance genes or no resistance genes (% resistanta) (n |
|---|---|---|
| Penicillin | 100 | 100 |
| Methicillin | 87.5 | 15.25 |
| Ampicillin | 87.5 | 25.40 |
| Cefotaxime | 62.5 | 25.40 |
| Ciprofloxacin | 75.0 | 33.90 |
| Amikacin | 50.0 | 10.20 |
| Erythromycin | 87.5 | 44.00 |
| Clindamycin | 37.5 | 15.25 |
| Vancomycin | 12.5 | - |
aPercentage of strains resistant according to the Clinical and Laboratory Standards Institute breakpoints. |
Discussion
S. aureus is a major pathogen causing significant morbidity and mortality.12 The important reservoirs of S. aureus are hospitals and institutions, where methicillin-resistant S. aureus (MRSA) is found to be the major cause of nosocomial infections. Infected or colonized patients act as reservoirs, with transient hand carriage by healthcare workers and caretakers of these patients being the predominant mode of transmission from one patient to another.13 During the last 15 years, the appearance and worldwide spread of many clones has caused major therapeutic problems in many hospitals, as well as the diversion of considerable resources to attempts at controlling their spread.9
In this study we determined the prevalence of pathogenic S. aureus in various sampling locations (vegetable shops, mutton shops, hospitals, medical stores, restaurants, and snack corners) in Dehradun and Delhi, and also the presence of virulence genes. We isolated a total of 74 staphylococci, of which 67 were proved to be S. aureus after performing various biochemical assays. The findings of the study were as expected; the maximum number of isolates was recovered from hospitals and mutton shops in both cities. S. aureus is a well-reported pathogen in warm blooded animals worldwide. Also, among the different pathogenic bacterial species, S. aureus is one of the most frequent pathogens of bovines.14 In hospitals, pathogens have suitable conditions for survival; besides infected patients, infected material such as knives, surgical instruments, and many different types of equipment may serve as sources of contamination and transmission. From such sources, organisms are transferred from one person to another if infection control practices are inadequate, leading to infection.15, 16
Recently Ko et al.17 reported the distribution of a single genotype of S. aureus (collected from hospitals in 12 countries) among different Asian countries, including China, India, Indonesia, Philippines, Saudi Arabia, Singapore, Sri Lanka, Taiwan, Thailand, and Vietnam. This suggests low genetic diversity but a high persistence of the pathogenic strains in different areas. Therefore, the possibility of spread of such strains from hospitals to the community cannot be ignored.
Pathogenicity of the isolates was evaluated by different biochemical assays. Seven isolates were able to produce β-hemolysis, eight were positive for coagulase reaction and were confirmed to be pathogenic. Thirteen isolates were positive for DNase activity on DNase toluidine blue agar. Sixteen isolates showed themselves to be pathogenic when grown on S. aureus-specific agar medium (Hi Media Pvt., Ltd). Among the above, only SA 4, SA 19, SA 25, and SA 33 were consistent in their results, while variation was observed in the other isolates with different assays. Such findings are quite possible if a pathogenic organism is present in the external environment without any interaction with a suitable host for a long time. As a result, some of the virulence genes become suppressed and are not able to be expressed during the performance of different biochemical assays.
It was found that the maximum number of isolates able to define their pathogenicity was from the paper currency collected in hospitals, followed by mutton shops. Confirmed cases of pathogenic/virulent strains of S. aureus have long been reported in hospitals. S. aureus has also been found to be associated with wounds and burns in hospitals, and may be transmitted to other persons either via equipment or by contact. Researchers have proven in their findings that hospitals are the major source for the spread of pathogenic S. aureus into the environment.18, 19 Less commonly, a colonized or infected healthcare worker may disseminate the organism. Environmental contamination is uncommon, but may have been an important route of transmission in a burns unit, and droplet transmission may have occurred during the care of an infected patient with MRSA pneumonia.20 Also, a healthy person connected with the patient and perhaps the patient himself may serve as a potent source of pathogen transmission from hospital to medical store during the purchase of medicine, when paper currency is exchanged. Therefore, these patients or healthcare workers having pathogenic inoculums on their skin/hands can further transmit the pathogen during money transactions. The characteristics of inoculums like virulent/non-virulent, antibiotic-resistant/susceptible, etc. will decide the transfer of the same inoculum of S. aureus in the respective environment. In our study, restaurants were found to be least prone to contamination with S. aureus. This may be because these places have no significant contact with any of the above-stated modes of transmission of S. aureus and because hygiene levels are maintained at such places.
Although the availability and frequency of S. aureus on paper currency collected from different places varied with collection site, the presence of S. aureus on the currency clearly indicates that pathogenic microbes may spread this way. Our findings are supported by those of Bhalakia,4 who reported the transmission of S. aureus from hospitals to the community with the transfer of paper currency. He has also reported the transfer of resistant organisms by this mode, but no data on the availability of virulence genes was available.
Though several virulence-associated genes in S. aureus are known, our preliminary study focused only on a small subset. These (cna, hlg, icaA, sdrE) were chosen because they have been determined to be more common among invasive isolates.11 Amplification of the genes revealed that all four were present among the different S. aureus isolates. The number of different combinations found, in which all four selected genes were present in only eight isolates, indicates that the genetic diversity of S. aureus is high in the environment. In our study, significant differences in antimicrobial susceptibility were observed between those S. aureus isolates carrying all four virulence genes and those carrying variable or no virulence genes. The S. aureus isolates with all four virulence genes were found to be more resistant in comparison to those carrying fewer or no virulence genes. The reason for this may be the adjacent location of the resistance gene to the virulence gene.6, 21
Although the data presented here are preliminary and do not prove that paper currency can transmit bacteria, the isolation and identification of S. aureus containing the four virulence-associated genes clearly suggests that this type of currency may be a potent non-conventional mode for the spread of microbial pathogens. If they reach a suitable host and gain entry to the host system, this may lead to the development of disease. However, exhaustive sampling, a wider geographical area, and a long-term study are needed to establish any concrete conclusion. The data presented in this manuscript is a starting point; further research will determine the actual prevalence of S. aureus and other potential pathogens, e.g., Mycobacterium tuberculosis, Acinetobacter spp, Pseudomonas spp, etc. on paper currency.
Acknowledgements
We are thankful to the Chairman, MS and Director SBSPGI for providing helpful guidance and financial assistance during the course of this study.
Conflict of interest: No conflict of interest to declare.
References
- . Common themes among bacteriophage encoded virulence factors and diversity among the bacteriophage involved. Trends Microbiol. 2002;10:521–529
- . The changing epidemiology of Staphylococcus aureus. Emerg Infect Dis. 2001;6:178–182
- . Is Staphylococcus aureus an intracellular pathogen?. Trends Microbiol. 2000;8:341–343
- . Isolation and plasmid analysis of vancomycin-resistant Staphylococcus aureus. J Young Investig. 2006;16:4
- . Typing of Staphylococcus aureus from mobile phones and clinical samples. Curr Sci. 2006;90:1524–1528
- . Virulence and antibiotic resistance gene combinations among Staphylococcus aureus isolates from coastal waters of Oahu, Hawaii. J Young Investig. 2004;12:3256–3263
- . Emergence of vancomycin resistance in Staphylococcus aureus. N Engl J Med. 1999;340:403–405
- . Bergey's manual of determinative bacteriology. 9th ed. Baltimore, MD: Williams and Wilkins; 1994;p. 151–7
- . Staphylococcus: cluster forming Gram-positive cocci. In: Collee JG, Fraser AG, Marmion BP, Simmons A editor. Mackie and McCartney practical medical microbiology. 14th ed.. New York: Churchhill Livingstone; 1996;p. p247
- Miniprep of bacterial genomic DNA. In: Ausbel FM, Brent R, Kingston RE, Moore DD, Seidman JG, Smith JA, et al. editor. Short protocols in molecular biology. 4th ed.. USA: John Wiley & Sons; 1999;p. 2.12–2.13
- Virulent combinations of adhesion and toxin genes in natural populations of Staphylococcus aureus. Infect Immun. 2002;70:4987–4996
- An outbreak of methicillin-resistant Staphylococcus aureus (MRSA) infection in dermatology indoor patients. Indian J Dermatol Venereol Leprol. 2003;69:377–380
- . The epidemiology of methicillin-resistant Staphylococcus aureus: surgical relevance 20 years on. Aust N Z J Surg. 1997;67:682–685
- . Staphylococcus aureus isolates carrying Panton–Valentine leucocidin genes in England and Wales: frequency, characterization, and association with clinical diseases. J Clin Microbiol. 2005;43:2384–2390
- . The evolving epidemiology of methicillin-resistant Staphylococcus aureus at a university hospital. J Infect Control Hosp Epidemiol. 1995;16:12–17
- . Study of methicillin-resistant Staphylococcus aureus (MRSA) isolates from high risk patients. Indian J Med Microbiol. 2001;19:13–16
- Distribution of major genotypes among methicillin-resistant Staphylococcus aureus clones in Asian countries. J Clin Microbiol. 2005;43:421–426
- Methicillin-resistant Staphylococcus aureus. A consensus review of microbiology, pathogenesis and epidemiology with implication for prevention and management. Am J Med. 1993;94:313–324
- . Community-acquired methicillin-resistant Staphylococcus aureus: an emerging threat. Lancet Infect Dis. 2005;5:275–286
- Pneumonia in patients with severe burns. Chest. 2001;119:1160–1165
- . The yje gene is required for virulence of S. aureus. Infect Immun. 2006;74:4918–4921
PII: S1201-9712(09)00134-9
doi:10.1016/j.ijid.2009.02.020
© 2009 International Society for Infectious Diseases. Published by Elsevier Inc. All rights reserved.
Volume 13, Issue 6 , Pages e450-e455, November 2009
