If you don't remember your password, you can reset it by entering your email address and clicking the Reset Password button. You will then receive an email that contains a secure link for resetting your password
If the address matches a valid account an email will be sent to __email__ with instructions for resetting your password
Laboratorio de Genética Molecular “Dr. Jorge Yunis-Turbay”, Decanato de Ciencias de la Salud, Universidad Centroccidental Lisandro Alvarado (UCLA), Barquisimeto, Venezuela
Laboratorio de Genética Molecular “Dr. Jorge Yunis-Turbay”, Decanato de Ciencias de la Salud, Universidad Centroccidental Lisandro Alvarado (UCLA), Barquisimeto, Venezuela
Laboratorio de Genética Molecular “Dr. Jorge Yunis-Turbay”, Decanato de Ciencias de la Salud, Universidad Centroccidental Lisandro Alvarado (UCLA), Barquisimeto, Venezuela
Helicobacter pylori is a major cause of chronic gastritis and an established risk factor for gastric adenocarcinoma. This bacterium also exhibits an extraordinarily high genetic diversity.
Methods
The genetic diversity of H. pylori strains from Venezuelan patients with chronic gastritis was evaluated by PCR-typing of vacA, cagA, iceA, and babA2 virulence-associated genes using DNA extracted directly from biopsies. The nucleotide sequence and prevalence of size variants of iceA1, iceA2, and babA2 PCR products were introduced in this analysis.
Results
The frequency of vacA s1 was associated (p < 0.01) with moderate/severe grades of atrophic gastritis. The cagA, iceA1, iceA2, and babA2 genotypes were found in 70.6%, 66.4%, 33.6%, and 92.3% of strains, respectively. The frequency of iceA2 and its subtype iceA2_D were higher (p < 0.015) in cases with moderate/severe granulocytic inflammation. The most prevalent combined genotypes were vacA s1m1/cagA/iceA1/babA2 (26.3%), vacA s2m2/iceA1/babA2 (19.5%), and vacA s1m1/cagA/iceA2/babA2 (18.8%). Sequence analysis of iceA1, iceA2, and babA2 PCR-amplified fragments allowed us to define allelic variants and to increase the number of genotypes detected (from 19 to 62). A phylogenetic tree made with iceA1 sequences showed that the H. pylori strains analyzed here were grouped with those of Western origin.
Conclusions
Our results show that patients from the western region of Venezuela have an elevated prevalence of infection with H. pylori strains carrying known virulence genotypes with high genetic diversity. This highlights the importance of identifying gene variants for an early detection of virulent genotypes.
Helicobacter pylori is a Gram-negative spiral-shaped bacterium that persistently colonizes the human gastric mucosa. The presence of the bacterium causes chronic inflammation that may lead to non-cardia gastric adenocarcinoma, gastric lymphoma, and peptic ulceration.
This fact could be associated either with the genetic diversity of H. pylori, or with the particular host genetic background, and/or specific interactions between a particular strain and its host.
The genetic diversity in H. pylori is greater than that exhibited by most bacteria, with exceptionally high rates of DNA point mutations and intra- and inter-genomic recombination that allow its adaptation to changing environments.
The most significant consequences of these genomic changes are antibiotic resistance and differences in the prevalence or expression of bacterial virulence factors that may determine the clinical outcome of gastric diseases.
Several genes, such as vacA, cagA, iceA, and babA2, have been identified as markers for enhanced pathogenicity of H. pylori. The vacuolating cytotoxin gene (vacA) is present in all H. pylori strains.
Specifically, s region variations are associated with the vacuolating activity of VacA, whereas variations in the m region determine the cell specificity of vacuolation, by affecting the binding of the toxin to the host cells. Toxin production is highest in s1/m1 strains, moderate in s1/m2 strains, and scarce or null in H. pylori expressing s2/m2 forms.
Diversity of Helicobacter pylori vacA and cagA genes and relationship to VacA and CagA protein expression, cytotoxin production, and associated diseases.
The cagA gene is a marker for the presence of the cag pathogenicity island (cag-PAI) of approximately 40 kb, whose presence is associated with the more severe clinical outcomes.
A type IV secretion system translocates CagA protein into gastric epithelial cells, where it is phosphorylated. When this modification occurs, CagA affects various cellular processes and signal transduction pathways, such as disruption of tight and adherent junctions that lead to proinflammatory and mitogenic responses–effects.
Another putative virulence factor is IceA, whose gene has two main allelic variants, iceA1 and iceA2. The expression of iceA1 is up-regulated on contact of H. pylori with human epithelial cells and may be linked with peptic ulcer disease.
H. pylori infection is very common in Venezuela and gastric cancer is an important cause of cancer-related death in this country. Although our group and others have recently reported the prevalence of H. pylori and host genetic factors associated with gastric diseases,
Combination of Helicobacter pylori iceA2 and proinflammatory interleukin-1 polymorphisms is associated with the severity of histological changes in Venezuelan chronic gastritis patients.
Infection with specific Helicobacter pylori cag pathogenicity island strains is associated with interleukin-1B gene polymorphisms in Venezuelan chronic gastritis patients.
few studies have investigated the genetic diversity of this pathogenic bacterium in Venezuela. The aim of this work was to assess the genetic diversity of H. pylori strains infecting patients with chronic gastritis in the western region of Venezuela through the evaluation of the prevalence of several genes coding for virulence factors.
2. Methods
2.1 Patient samples
A total of 148 H. pylori-positive patients (52 men and 96 women) diagnosed with chronic gastritis by histopathological analysis were included in this study. Their mean age was 44 years (range 18–88 years). Patients with criteria indicating an endoscopy were referred to the Gastroenterology Service of the Hospital Antonio María Pineda (HAMP), Barquisimeto, Venezuela. Exclusion criteria were: age under 18 years, previous gastric surgery and H. pylori eradication treatment, history of bleeding and coagulation disorders, consumption of antibiotics during the 3 months preceding endoscopy, and consumption of bismuth salts, proton pump inhibitors, or sulcrafate in the previous month. Six biopsies were obtained from each patient: three from the antrum and three from the gastric corpus.
Two antral and two corpus sections of each patient were stained with hematoxylin–eosin and evaluated by two independent expert pathologists from the Department of Pathology (HAMP-UCLA). The evaluation was performed in accordance with the Sydney classification system with regard to the presence and degree of atrophic gastritis (N/M: no/mild; M/S: moderate/severe), granulocytic infiltration (G0/G1: absence/mild; G2/G3: moderate/severe), and lymphocytic infiltration (L0/L1: absence/mild; L2/L3: moderate/severe). The remaining biopsies were used for DNA isolation by Wizard Genomic DNA Purification Kit (Promega), in accordance with the manufacturer's instructions. For the PCR reactions we used 1–2 μl of genomic DNA.
2.2 H. pylori status and genotyping
Identification of the cagA, vacA s1/s2, vacA m1/m2, iceA1/A2, and babA2 genotypes was carried out using primer sets selected from previous published works (Table 1).
Specific PCR reactions were conducted in a final volume of 25 μl containing 0.4–0.8 μM of each primer, 0.2 mM dNTPs, 1.5 mM MgCl2, and 1.25 U of GoTaq DNA Polymerase (Promega), under the cycling conditions shown in Table 1. Samples confirmed as H. pylori-positive by PCR detection of the vacA gene were included in the study.
Table 1PCR primers for amplification of vacA, cagA, iceA1, iceA2, and babA2 sequences
Gene
Primer sequence (5′ → 3′)
PCR conditions
Reference
vacA
s1/s2
VAI-F
ATGGAAATACAACAAACACAC
94 °C, 1 min; 50 °C, 1 min; 72 °C, 1 min (35 cycles)
Chattopadhyay et al. (2004)
VAI-R
CTGCTTGAATGCGCCAAAC
m1/m2
VAG-F
CAATCTGTCCAATCAAGCGAG
94 °C, 1 min; 50 °C, 1 min; 72 °C, 1 min (35 cycles)
Chattopadhyay et al. (2004)
VAG-R
GCGTCAAAATAATTCCAAGG
cag-PAI empty site
Luni 1
ACATTTTGGCTAAATAAACGCTG
94 °C, 1 min; 56 °C, 30 s; 72 °C, 45 s (35 cycles)
Rahman et al. (2003)
R5280
GGTTGCACGCATTTTCCCTTAATC
iceA1
iceA1F
TATTTCTGGAACTTGCGCAACCTGAT
94 °C, 1 min; 55 °C, 45 s; 72 °C, 45 s (35 cycles)
Rahman et al. (2003)
M.Hpy1R
GGCCTACAACCGCATGGATAT
cagA
cag5c-F
GTTGATAACGCTGTCGCTTC
94 °C, 1 min; 50 °C, 1 min; 72 °C, 1 min (35 cycles)
Chattopadhyay et al. (2004)
cag3c-R
GGGTTGTATGATATTTTCCATAA
iceA2
cycSf
CGGCTGTAGGCACTAAAGCTA
94 °C, 1 min; 55 °C, 45 s; 72 °C, 45 s (35 cycles)
Rahman et al. (2003)
IceA2R
TCAATCCTATGTGAAACAATGATCGTT
babA2
bab7-F
CCAAACGAAACAAAAAGCGT
94 °C, 1 min; 57 °C, 45 s; 72 °C, 30 s (35 cycles)
Several iceA1, iceA2, and babA2 PCR products were purified with a Wizard SV Gel and PCR Clean-Up System (Promega). DNA sequencing was performed using an ABI-PRISM BigDye Terminator Cycle Sequencing Kit (Applied Biosystems) in an ABI-PRISM 3100 Genetic Analyzer (Applied Biosystems). Sequencing was performed at least twice using the same primers (forward and reverse) as in the PCR assays. DNA sequence editing and analysis were performed with DNA for Windows v. 2.2 and DNAMAN (Lynnon Corporation). All the sequences were compared with GenBank nucleotide and protein databases using Blastn and Blastx algorithms, respectively (http://www.ncbi.nlm.nih.gov/blast).
2.4 Nucleotide sequence accession numbers
The GenBank/EMBL/DDBJ accession numbers for the sequences determined in this study are and for the iceA1 gene, to for the iceA2 gene, and to for the babA2 gene.
2.5 Phylogenetic analysis
iceA1 sequences from 34 strains reported in different parts of the world (available in public databases: GenBank, EMBL, and DDB) and two iceA1 sequences produced in the present work were used to construct a phylogenetic tree. For this analysis we selected sequences that showed query coverage of more than 95% with a 381-nt region of our sequences (corresponding to a hypothetical open reading frame (ORF)). Multiple nucleotide alignments were carried out using ClustalW. A neighbor-joining tree was constructed with MEGA 5 software using the bootstrap method at 1000 replications with the two-parameter model of Kimura.
2.6 Statistical analysis
The Chi-square or Fisher's exact test was used to compare the differences among the various groups. Logistic regression analysis was used to calculate the odd ratios (ORs) for the dependent variable. A p-value of <0.05 was considered statistically significant. These estimations were performed with SSPS 11.0 software.
3. Results
3.1 Studied sample
All 148 samples included in this study were successfully typed for cagA, vacA s1/s2, vacA m1/m2, iceA1/A2, and babA2 genes from DNA extracted from the gastric biopsies. Patients who were positive for the presence of more than one allele per gene were excluded from the analysis of association with histological changes in the gastric mucosa.
3.2 vacA and cagA genotypes
The most virulent vacA s1 allele was predominantly (65.0%) present in chronic gastritis samples (Table 2). The middle region vacA m1 allele was found in 53.1%. There was a statistical association (p < 0.01) between vacA s1 and M/S atrophic gastritis. vacA s1m1, vacA s1m2, and vacA s2m2 genotypes were observed in 53.1%, 11.9%, and 35.7%, respectively, and although the frequency of vacA s1m2 was lower, this genotype showed a significant association with M/S atrophic gastritis (p < 0.03).
Table 2Distribution of Helicobacter pylori vacA and cagA status according to histological changes in chronic gastritis patients
The cagA gene was detected in 70.6% of the H. pylori-infected patients (Table 2). The combination vacA s1m1/cagA+ was the most frequent among cagA-positive samples (52.4%), moreover, these ‘double-positive’ strains represented 98.6% (75/76) of the vacA s1m1 samples. The cagA-negative status, in samples that did not yield a cagA gene-specific product with cag5c-F/cag3c-R primers, was confirmed by obtaining an empty cag-PAI site-specific 550-bp amplicon (Table 1).
3.3 Prevalence of iceA and babA2 genotypes and variants of PCR-amplified fragments
The iceA gene was detected in all samples (Table 3); 66.4% (95/143) were positive for iceA1 and 33.6% (48/143) for iceA2 alleles. On amplification of the iceA1 gene with primers iceA1F and M.Hpy1R,
we noticed that the size of the PCR products was slightly different among samples, and after sequence analysis, we defined two subtypes of iceA1 fragments (iceA1_A: 740 bp, and iceA1_B: 758 bp) that differed by the presence or absence of 16 bp at the 5′ end of the iceA1 gene (Table 3; see also Supplementary Material Figure S1). Out of the 95 patients positive for iceA1 strains, 24 (25.3%) were infected with the subtype iceA1_A and 71 (74.3%) harbored the iceA1_B allele (Table 3). The mentioned variation in iceA1 gene nucleotide sequence can be observed in H. pylori reference strains from different continents.
Table 3Distribution of Helicobacter pylori iceA and babA2 status according to histological changes in chronic gastritis patients
Because of the detection of more than one subtype of iceA2 and babA2 in some samples, frequencies for these subvariants were determined considering a sample size of 142 and 141, respectively.
Because of the detection of more than one subtype of iceA2 and babA2 in some samples, frequencies for these subvariants were determined considering a sample size of 142 and 141, respectively.
Because of the detection of more than one subtype of iceA2 and babA2 in some samples, frequencies for these subvariants were determined considering a sample size of 142 and 141, respectively.
Because of the detection of more than one subtype of iceA2 and babA2 in some samples, frequencies for these subvariants were determined considering a sample size of 142 and 141, respectively.
Because of the detection of more than one subtype of iceA2 and babA2 in some samples, frequencies for these subvariants were determined considering a sample size of 142 and 141, respectively.
Because of the detection of more than one subtype of iceA2 and babA2 in some samples, frequencies for these subvariants were determined considering a sample size of 142 and 141, respectively.
Because of the detection of more than one subtype of iceA2 and babA2 in some samples, frequencies for these subvariants were determined considering a sample size of 142 and 141, respectively.
28
(22.6)
5
(29.4)
25
(22.3)
8
(27.6)
22
(22.7)
11
(25.0)
33
(23.4)
N/M, no or mild; M/S, moderate/severe; G0/G1, absence/mild; G2/G3, moderate/severe; L0/L1, absence/mild; L2/L3, moderate/severe.
a p < 0.015.
b Because of the detection of more than one subtype of iceA2 and babA2 in some samples, frequencies for these subvariants were determined considering a sample size of 142 and 141, respectively.
The prevalence of the iceA2 gene was higher in patients with severe histopathological changes (Table 3): N/M atrophic gastritis, 32.5% vs. M/S atrophic gastritis, 41.2%; G0/G1, 28.1% vs. G2/G3, 55.2% (p < 0.015); and L0/L1, 29.3% vs. L2/L3, 43.2%. The iceA2-specific PCR performed in this work yielded fragments of 546 bp (n = 4), 651 bp (n = 27), and 756 bp (n = 16) (Table 3), which according to DNA sequence analysis corresponded to the iceA2_A, B, and D variants described by Figueiredo et al.
More specifically, we found that the iceA2_D subtype was predominant in G2/G3 cases (p < 0.015 vs. G0/G1). One sample, not included in the association analysis, showed a simultaneous amplification of iceA2_B and D fragments.
The babA2 gene was detected in 92.3% of patients (Table 3) and no statistically significant differences were found between its distribution and histological changes. Variations in the 5′ end of the babA2 gene amplified by primers bab7-F/R resulted in fragments of four different sizes. These babA2 subtypes were confirmed by sequence: babA2_A (210 ± 1 bp), babA2_B (234 bp), babA2_C (250 ± 2 bp), and babA2_D (269 bp) (see Supplementary Material Figure S2), representing 8.5%, 29.5%, 36.4%, and 25.6% of the babA2-positive samples. Only two samples were observed with coexistence of two babA2 subtypes (not included in the above analysis). Analysis of some babA2 nucleotide sequences showed CT repeats at the 5′ end of the gene (Supplementary Material Figure S2); these repeats have been associated with translocation processes that originate chimeric babB/babA genes.
3.4 Genotype combinations
The frequency distributions of the combined genotypes of H. pylori in the 148 samples included in the study are presented in Table 4. We registered a total of 19 different genotype combinations, out of which the four more abundant were: vacA s1m1/cagA/iceA1/babA2 (26.3%), vacA s2m2/iceA1/babA2 (19.5%), vacA s1m1/cagA/iceA2/babA2 (18.8%), and vacA s1m2/cagA/iceA1/babA2 (6.8%). When we took into consideration the subtypes of iceA1, iceA2, and babA2 found in this work, the number of different genotypes increased to 62 (Table 4). In this manner, the most prevalent genotypes vacA s1m1/cagA/iceA1/babA2 and vacA s2m2/iceA1/babA2, included 10 and 12 subtypes or subgenotypes, respectively.
Table 4Frequency distribution of Helicobacter pylori combined genotypes in chronic gastritis patients
No.
Genotype
n
(%)
Number of genotypes taking into consideration subtypes of iceA1, iceA2, and babA2 genes
To assess the phylogenetic relationship between Venezuelan H. pylori strains and those from other geographic regions, we used a region of 381 bp of the iceA1 PCR-amplified fragments, corresponding to an ORF from a second putative ATG translation initiation site. For this analysis we also included the sequences of iceA1_A (V132) and iceA1_B (V133) subtypes (Figure 1). Sequences obtained from Venezuelan samples were closely related to those from Western strains (excluding Alaska). Interestingly, reference strains of H. pylori obtained from Amerindians of South America (PeCan4, Puno135, SJM180, and v225d) clustered in a group separated from the Venezuelan sequences analyzed here, being more closely related to East Asian strains.
Figure 1Phylogenetic tree based on the 381-bp sequence of the iceA1 gene of Helicobacter pylori strains from Venezuela (this work) and sequences of strains reported from different parts of the world (available in public databases). The neighbor-joining tree was generated using MEGA 5 software and the bootstrap method at 1000 replications and the Kimura two-parameter method. The strains used are as follows (GenBank accession numbers are in parenthesis): Alaska 214 (), Alaska 218 (), Alaska 209 (), AR-25 (), AR-84 (), B8 (), CH4 (), CR2 (), CR15 (), CR35 (), CR38 (), F16 (), F30 (), F43 (), F72 (), Hp51 (), Hp52 (), Hp83 (), HPAG1 (), India34A (), India227 (), OK99 (), OK108 (), OK113 (), PeCan4 (), Puno135 (), P12 (), SouthAfrica7 (), SJM180 (), v225d (), V132 (), V133 (), 26695 (), 60190 (). Geometric shapes mark the geographic origins of the bacterial isolates.
In this work we proposed a strategy of detection by PCR of allelic variants of several genotypic markers associated with an increased risk of disease, to evaluate the prevalence and genetic diversity of circulating H. pylori strains. In accordance with previous studies in Venezuelan populations,
we found a high frequency of vacA s1 and m1 alleles, cagA gene, as well as the vacA s1m1 genotype. The vacA s1 allele was observed to be associated with more severe atrophic gastritis, and although vacA s1m2 and vacA s1m2/cagA genotypes were not the most prevalent in chronic gastritis samples, their frequencies were also higher in M/S atrophic gastritis (p< 0.01) because of the strong correlation existing between vacA m2 and cagA-positive alleles with vacA s1.
In a previous work we found no association between cagA-positive strains and histological changes in chronic gastritis.
Infection with specific Helicobacter pylori cag pathogenicity island strains is associated with interleukin-1B gene polymorphisms in Venezuelan chronic gastritis patients.
It is known that approximately half of the H. pylori strains isolated in Western countries do not carry the cag-PAI (considered as cagA-negative), and although it is known that in Western populations cagA-positive strains are commonly associated with peptic ulceration, atrophic gastritis, and gastric adenocarcinoma, the levels of inflammation and atrophy are significantly higher in patients infected with East Asian cagA-positive strains than in patients infected with Western cagA-positive strains.
24% (12/50) of analyzed samples harboring the vacA s2m2 genotype also contained the cagA gene. Moreover, a recent study showed that 66% of H. pylori strains were vacA s2m2/cagA+ (predominantly non-Asian cagA-positive strains), almost all of them isolated from Alaskan native individuals.
iceA1 was the more frequently found allele of this locus; nonetheless, iceA2 prevalence was higher in samples with atrophic gastritis and more severe grades of granulocytic and lymphocytic infiltration. According to the present work, this trend, and the association with G2/G3, is mainly due to the presence of iceA2_D subtype. Although the function of the iceA2 product remains unclear, Kidd et al.
were able to discriminate a potential association between iceA2_D subtype and peptic ulcer disease.
A high frequency of the babA2 allele is more common in East Asia, but it has also been reported in other Western countries when the primers described by Sheu et al.
These primers were designed to detect a 10 bp deletion in the signal region of the babA gene with the idea of establishing a firm association between babA2-positive strains and the expression of a functional protein, thus avoiding the underestimation that occurs when using primers located in polymorphic zones of the gene.
However, the presence of CT repeats close to the babA start codon in some PCR products suggests the presence of chimeric babA2/B genes and that the protein production is subject to a phase variation through slipped-strand mispairing.
information obtained from currently used PCR-based methods to evaluate babA status must be interpreted with caution. In this work, taking advantage of the fact that the PCR reaction yielded products of different sizes, we defined four babA2 subtypes that varied in the promoter region of the gene.
One striking characteristic of the pathogenic bacterium H. pylori is its remarkable allelic diversity and genetic variability, a fact that determines that every isolate from unrelated subjects appears to have a distinct fingerprint.
Also given the elevated mutation rate and frequent recombination of H. pylori during the course of chronic infection, strains may undergo genetic alterations in vivo.
Both housekeeping and virulence-associated genes are affected by genetic variability, and it is believed that this variability may play a role in human host adaptation. In this work we showed that the number of different genotype combinations increased from 19 to 62 when PCR-product size variants of iceA1, iceaA2, and babA2 were considered. In other words, by PCR-typing polymorphic virulence genes, a different genotype was observed in every 2.4 analyzed individuals, a fact that highlights the elevated variability of the strains circulating in Venezuela.
The heterogeneity of H. pylori genotype observed can be considered on two levels: genotypic variation among strains and variations in H. pylori populations within an individual host. The first one can include, in our samples, the presence of non-conserved genes (e.g., cagA) and/or mosaic forms of gene elements (e.g., iceA1_A and B), while population differences involve the fact that the human can be simultaneously infected with more than one H. pylori strain, and that a single strain may represent a cluster of closely related organisms or quasispecies.
Although the aim of this work was not to study the prevalence of mixed infections, some of the obtained genotype combinations suggest the presence of co-infections with divergent H. pylori strains.
showed that strains isolated from a high-risk region (Andes Mountains, Nariño) for gastric cancer were all of European origin, thus suggesting that the phylogeographic origin of H. pylori strains may explain geographic differences in gastric cancer prevalence. Analysis of iceA1 sequences clearly showed that Venezuelan strains clustered closer to those of Western countries. But even though the number of iceA1 sequences from Western strains available in the databases is limited, our phylogenetic tree was similar to that reported for other H. pylori virulence-associated and housekeeping genes.
an iceA1 sequence from a characterized Venezuelan Amerindian strain (v225d) grouped with ‘Amerindian cluster’ close to East Asian strains. Our results are consistent with the admixed ethnic origin of the population of the central–western region of Venezuela, and also with the hypothesis stating that similarities between the Amerindian and East Asian strains are due to the first colonizers of the New World who brought H. pylori with them.
In summary, we determined virulence-associated genotypes of H. pylori using known, and newly defined in this work, allelic variants, to demonstrate the high genetic variability of strains circulating in the central–western region of Venezuela, whose population exhibited a high prevalence of infection with H. pylori strains harboring genes and allelic forms associated with disease outcome. Even though it is unknown whether any association of the studied variants with BabA or IceA1 expression exists, we propose that they may be used for comparative studies of the genetic diversity of H. pylori strains. A more systematic analysis of the impact of this genetic heterogeneity in H. pylori-infected patients from Venezuela is required. Moreover, to our knowledge this is the first attempt to use H. pylori iceA1 sequences to make a phylogenetic tree, which allowed us to group H. pylori strains from a Venezuelan urban/admixed population with Western strains.
Acknowledgements
This study was supported by a CDCHT-UCLA grant (No. 025-ME-2005). We thank L. Mendoza and M.E. Camargo for their technical assistance. We would also like to thank E. Armanie for endoscopic biopsy sampling and A. Alvarez for help with the histology analysis. Mrs S. Sumpter provided assistance with the English language.
Ethical approval: This study was approved by the Bioethics Committee of the School of Health Sciences, Universidad Centroccidental Lisandro Alvarado (UCLA), and all patients gave their written informed consent to participate in the study.
Conflict of interest: No conflict of interest to declare.
Diversity of Helicobacter pylori vacA and cagA genes and relationship to VacA and CagA protein expression, cytotoxin production, and associated diseases.
Combination of Helicobacter pylori iceA2 and proinflammatory interleukin-1 polymorphisms is associated with the severity of histological changes in Venezuelan chronic gastritis patients.
Infection with specific Helicobacter pylori cag pathogenicity island strains is associated with interleukin-1B gene polymorphisms in Venezuelan chronic gastritis patients.
00125-2&id=gr1.gif){kind=link}