If you don't remember your password, you can reset it by entering your email address and clicking the Reset Password button. You will then receive an email that contains a secure link for resetting your password
If the address matches a valid account an email will be sent to __email__ with instructions for resetting your password
Globally, cervical cancer is the fourth most common cancer in women and the seventh most common cancer overall, accounting for an estimated 300 000 annual deaths. Human papillomavirus (HPV) is the second most common cause of cervical cancer worldwide. HPV screening is not a common practice in Pakistan. The aim of this study was to determine the prevalence of HPV and HPV types in women with a normal cytology of the cervix living in the upper and lower regions of Punjab, Pakistan, and to analyze the risk factors for HPV in this region.
Methods
PCR analysis was performed for 1011 female patients with a normal cytology of the cervix from various districts of Punjab Province, Pakistan. Risk factors for the acquisition of HPV were studied. High-risk HPV types (HPV16 and HPV18) were detected using the Abbott Real Time HR HPV test. To determine the genotype, partial L1 region sequences of HPV-positive samples were subjected to sequencing using MY/09/MY11 primers, and a phylogenetic tree was constructed using CLC software.
Results
The study found a 4.74% prevalence of HPV, with the most frequent HPV type found being the low-risk HPV6 (in 25% of infected individuals), followed by HPV55 (22.9%), HPV11 (20.8%), and high-risk types HPV45 (12.5%), HPV33 (8.33%), HPV18 (6.25%), and HPV16 (4.16%). Phylogenetic analysis of all HPV types in this study showed 80–99% nucleotide identity with types related to the same species. The sequences were clustered with China, India, Mexico, Iran, Slovenia, and Germany, showing the diversity in origin of the various genotypes prevalent in Pakistan.
Conclusions
In this population with a normal cervical cytology, the prevalence of high-risk HPV types was very low. The major prevalent HPV genotype in Punjab Province of Pakistan was the low-risk HPV type 6, followed by HPV type 55. Sequencing of the partial L1 region suggested that the region was highly conserved in all reported sequences. This study highlights the need to conduct robust epidemiological studies in the region and to develop regular HPV screening so that the situation does not reach an alarming stage resulting in cervical cancer.
). These viruses are specific and found in the epithelia of their respective hosts. Human papillomavirus (HPV) is a small double-stranded DNA virus belonging to the Papillomaviridae which has different genera (
). This virus is the second most common cause of cervical cancer worldwide. Cervical cancer is the fourth most common cancer of women in the world, and the seventh overall, with an estimated 528 000 new cases in 2012 and accounting for nearly 300 000 deaths annually (
). These are further categorized into two groups, i.e., ‘low-risk’ HPV types (LR-HPV) and ‘high-risk’ HPV types (HR-HPV), depending on their relative risk of causing human malignancy (
). HPV types 16 and 18 are considered as high-risk types for the development of cervical carcinoma, among many others that infect the anogenital tract.
Worldwide, the prevalence of HPV in normal women is nearly 10.5%, whereas in Asia it is about 8% (
). HPV is a widespread infection, although the majority of infected individuals can eliminate evidence of the virus without ever presenting any clinical manifestations. Many papillomaviruses cause chronic asymptomatic infections, thus reducing the risk of immune clearance, and as a result, a few HPV infections progress to the development of cervical cancer (
). Of note, the cellular environment and site of infection modulate viral gene expression and thus affect viral pathogenicity.
Around 70% of all cervical cancer cases across the globe are caused by HPV types 16 and 18. In Pakistan, the rate of cervical cancer is not exactly known, due to a lack of knowledge about the disease in terms of screening and epidemiological studies. It is estimated to be the third most common cancer in Pakistani women (
). Vaccines against HPV16 and HPV18 infections are now available and have the potential to reduce the incidence of cervical and anogenital cancers.
In recent years, a few small-scale studies have reported the prevalence of different HPV types in Pakistan. Some of these studies were conducted using formalin-fixed paraffin-embedded tissue from cervical cancer patients to establish an association between cervical cancer and HPV. These reports presented high prevalence rates of HPV in cervical cancer patients: 88.0%, 87.5%, 88%, and 94.81%. Furthermore, higher prevalence rates of HPV16 and HPV18 have been observed in these patients (
). However, these do not completely reflect the HPV-related disease burden, as only a small number of samples were studied.
Since HPV screening is not common practice in Pakistan, there is a lack of documentation regarding the incidence of HPV for the country. Moreover, modes of transmission and risk factors related to HPV have not yet been sufficiently evaluated. Study of the epidemiology of HPV in the country is hindered by social taboos related to sex and sexually transmitted infections (STIs). The socio-cultural restrictions pose a significant barrier to research on matters that involve STIs. As a result, data related to the quantification of the HPV burden in both cancer and non-cancer patients in Pakistan are scarce or non-existent.
In this study, the prevalence of HPV was evaluated in female patients with a normal cytology of the cervix residing in the upper and lower districts of Punjab, and the risk factors for HPV in this region were analyzed. Furthermore, genotypes commonly prevalent in the Pakistani population were determined.
Materials and methods
Patient selection and study design
A total of 1011 cervical samples were obtained from female patients who presented for general gynecological problems and underwent a per speculum examination. These samples were taken from married women, after they had provided informed consent. A questionnaire was also administered.
The samples were collected between March 2014 and January 2016 from patients attending the general gynecology outpatient department of tertiary care hospitals in the upper and lower Punjab region, i.e., the Pakistan Institute of Medical Sciences in Islamabad, Holy Family Hospital in Rawalpindi, Sheikh Zayed Hospital in Rahim Yar Khan, and a few other private clinics in the Punjab region. These hospitals see a high influx of patients from nearby districts in the vicinity. The women visited the hospitals for different clinical symptoms, such as lower abdominal pain, vaginal discharge, bleeding, itching, and infertility. All had a normal cytology on Pap smear test. The women ranged in age from 18 years to 82 years (mean 34.93 years). Due to social constraints, reluctance to undergo a pelvic examination, or not having permission from the husband, samples could only be obtained from those women who attended the hospital for a particular reason, and not from general healthy individuals. The cervical scrape was taken using a CellPath cytobrush and transferred to a tube containing 400 μl of phosphate buffered saline. This was snap-frozen within 20 min to −86 °C until further processing.
HPV DNA extraction
HPV DNA was extracted using a QIAmp DNA Mini Kit (Qiagen), in accordance with the manufacturer’s protocol. Briefly, the tubes were thawed and rigorously vortexed for 1 min, following which the cytobrush was removed from the tube. Two microliters of Qiagen protease stock solution and 400 μl of lysis buffer were then added. The tubes were rigorously vortexed for 15 s, followed by incubation at 56 °C for 1 h. Four hundred microliters of pure ethanol was then added and the mixture washed twice in spin columns using Wash Buffer I and II. The columns were then centrifuged again at 20 000 g for 3 min to remove any remaining buffer and the contents transferred to sterile collection tubes and eluted with 50 μl of elution buffer. The columns were centrifuged at 6000 g for 1 min and discarded. The concentration of extracted DNA was determined by spectrophotometry at 260 nm. Total extracted DNA (10 ng) was used for PCR amplification.
HPV detection
HPV typing was done for an age-stratified random sample of 1011 women with a normal cytology on Pap smear in four age groups: <24 years, 25–35 years, 36–45 years, and >45 years.
Cervical scrapes from the patients were used for HPV typing based on L1 region-specific primers, following the methods used by Shikova et al. (
), with a few modifications. Each primer was found to be specific with no false-positive result obtained. Every reaction was repeated twice to exclude any chance of non-specific results. General consensus primer set MY09/MY11 and GP5+/GP6+ mediated PCR was used for amplification of the conserved L1 region DNA fragments, approximately 450 bp and 150 bp, respectively (Figure 1, Figure 2).
Figure 12% agarose gel stained with ethidium bromide showing 450 bp amplified product of primer set MY09/MY11. Lane 1 and 2 show negative and positive control respectively, while Lane 3–7 show amplified product of 450 bp. Lane M shows 100 bp ladder used as a marker.
Figure 22% agarose gel stained with ethidium bromide showing 150 bp amplified product of GP5+/GP6+. Lane 1 and 2 show positive and negative control respectively, while Lane 3 7 show amplified product of 150 bp. Lane M shows 50b p ladder used as a marker.
Briefly, a 50-μl final reaction volume was used for PCR amplification. Each reaction mixture contained Tris–HCl 10 mM (pH 8.5), KCl 50 mM, MgCl2 6 mM, AmpliTaqGold DNA polymerase 5 U (PE Applied Biosystems, Weisterstadt, Germany), 200 μM of each deoxynucleoside triphosphate (dNTPs), and primers MY09 (5′ CGTCCMARRGGATACTGATC 3′) and MY11 (5′ GCMCAGGGWCATAAYAATGG 3′) (
Distribution of 37 mucosotropic HPV types in women with cytologically normal cervical smears: the age-related patterns for high-risk and low-risk types.
). The GP5+/GP6+ amplification reaction was performed in a 50-μl final volume, which contained Tris–HCl 10 mM (pH 8.5), KCl 50 mM, 200 μM of each dNTPs, 3.5 mM MgCl2, AmpliTaqGold DNA polymerase 5 U (PE Applied Biosystems), and 50 pmol of primers GP5+ (5′ TTTGTTACTGTGGTAGATACTAC 3′) and GP6+ (5′ GAAAAATAAACTGTAAATCATATTC 3′). Two microliters of MY09/MY11 amplified product was used as a template for the reaction. The following cycling conditions were used: an activation step for 10 min for AmpliTaqGold DNA polymerase, 40 cycles of denaturation for 2 min at 94 °C, 2 min annealing at 40 °C, and elongation for 1.5 min at 72 °C. The last cycle was followed by a final extension step for 7 min at 72 °C (instead of 4 min).
HR-HPV typing
HR-HPV types were confirmed by Real Time HR HPV test using an m2000rt automated analyzer (Abbott Molecular Inc.) for PCR amplification and detection; an assay cycle threshold (Ct) cut-off of 32.0 and an internal quality control Ct target cut-off of 35.0 were used to interpret the results. As reported by the manufacturer, the assay is able to detect 14 HR-HPV types including HPV types 16, 18, 31, 33, 35, 39, 45, 51, 52, 56, 58, 59, 66, and 68; it can also partially genotype HPV types 16 and 18.
Genotype detection through partial sequencing of the L1 gene
The partial HPV L1 region was used for sequencing to validate HPV genotypes in all positive samples; this is considered the gold standard for HPV detection and typing (
). The MY09/MY11 primer set was used to amplify the L1 region to be sequenced. The PCR product was excised using 2% triacetate–ethylenediaminetetraacetic acid (TAE) agarose gel and purified using a Qiagen gel extraction kit following the manufacturer’s protocol. The PCR product was then sequenced using the dye-deoxy terminator method on an ABI Prism Sequencer (PE Applied Biosystems) using 5 pmol of either forward or reverse primer. The nucleotide sequences obtained as a result of sequencing were viewed using Chromas version 2.0. The electropherograms of all samples were analyzed and ambiguities in the sequence data were resolved by comparison of the results from both the forward and reverse primers. These sequences were aligned on CLC Main Workbench 6.0 to obtain a consensus sequence.
Eleven representative HPV L1 gene sequences from the present study and 36 sequences of various HPV genotypes retrieved from the NCBI nucleotide databank were used to construct a phylogenetic tree. CLC Main Workbench 6.0 was used to construct the phylogenetic tree through the neighbor-joining method with a bootstrap value of 100.
Statistical analysis
The statistical analysis was performed using IBM SPSS Statistics version 22 (IBM Corp., Armonk, NY, USA). The distributions and frequencies of HPV positivity and age were determined using descriptive statistics. Patients were stratified into the various age groups and the association of age with HPV prevalence was determined using the chi-square test. A p-value of <0.05 was considered statistically significant.
Results
This study provides a first insight into the prevalence of HPV in the female population with a normal cervical cytology in Punjab, Pakistan. Molecular HPV typing of 1011 cervical scrape samples was performed. Forty-eight samples were found to be positive for HPV DNA and were analyzed further. Overall, 4.7% (48/1011; 95% confidence interval (CI), 1.939–1.965) of women were positive for HPV; 2.27% (n = 23; 95% CI, 0.604–1.086) were from lower Punjab and 2.47% (n = 25; 95% CI, 0.893–1.587) were from upper Punjab.
Prevalence of HPV types
Among the HPV-infected female subjects, the frequency of LR-HPV types was 68.75% (33/48), while that of HR-HPV types was 31.25% (15/48). In descending order of frequency, the HPV types found in the study population were LR-HPV types 6 (12/48, 25%), 55 (11/48, 22.9%), and 11 (10/48, 20.83%), and HR-HPV types 45 (6/48, 12.5%), 33 (4/48, 8.33%), 18 (3/48, 6.25%), and 16 (2/48, 4.17%), as confirmed by dye-deoxy terminator method of DNA sequencing.
PCR amplification and detection using the Real Time HR HPV test on the m2000rt automated analyzer (Abbott Molecular Inc.) gave comparable results in detecting HPV16, HPV18, and 12 HR-HPV as ‘other HR-HPV types’. Two samples were confirmed to be HPV16 (Ct values 18.06 and 17.92) and three as HPV 18 (Ct values 20.88, 25.35, and 21.84), with a change in fold expression between 0.026 and 1.89.
The distributions of LR-HPV and HR-HPV types in the upper and lower Punjab were evaluated. In lower Punjab, the percentage of HR-HPV infection was double that in upper Punjab (10/48, 20.83% vs. 5/48, 10.42%). In contrast, upper Punjab reported a higher incidence of LR-HPV (19/48, 39.59%) than the lower Punjab region (14/48, 29.16%). The distributions of the different genotypes observed in the upper and lower Punjab region are shown in Figure 3. Different LR-HPV types were found in various divisions of the province.
Figure 3Overall genotype distribution among females belonging to Upper and Lower Punjab Region.
The highest prevalence of HPV was found among females in the age group 35–45 years (n = 20, 41.67%), followed by 24–35 years (n = 14, 29.17%), <24 years (n = 10, 20.83%), and >45 years (n = 4, 8.33%); the relationship with age was considered significant (p = 0.035). Figure 4 shows the distribution of HR- and LR-HPV types in the different age groups.
Figure 4Distribution of high and low risk HPV types in different age groups.
The results obtained in this study were further analyzed through a phylogenetic tree, which was constructed using the L1 region sequence as a phylogenetic marker. Genotype HPV11 reported in the present study clustered with HPV11 from China, Slovenia, and Hungary. Sequences of HPV18 clustered with HPV18 sequences from Thailand and the USA. Similarly, sequences of HPV45 from the present study clustered with those of Indonesia, Canada, and the USA. HPV33 sequences clustered with HPV33 sequences from the USA and China. The reported sequence for HPV16 clustered with HPV16 sequences from China, India, Mexico, Iran, and Germany. Similarly, HPV55 sequences were found to cluster with HPV55 sequences from Slovenia and Germany, while HPV6 sequences clustered with sequences from China and Slovenia, as indicated by the phylogenetic tree (Figure 5). The reported L1 region sequences were from 4237 bp to 7156 bp of the 8-kb long viral genome. Comparison of the sequences indicated that the HPV45 and HPV11 sequences showed 100% bootstrap value with sequences from the USA (accession number EF202165.1) and China (accession number EU918768.1), respectively.
Figure 5Phylogenetic tree showing various HPV types found in the present study (NORI HPV sequences) cluster with similar sequences from across the globe obtained from NCBI GenBank.
Knowledge regarding genital HPV infection is of great importance in infection control and the discovery of therapeutic interventions. HPV is a widespread sexually transmitted viral infection across the globe, with a high prevalence in developing countries. Pakistan, being a developing country, bears a significant burden of infectious diseases, but as for many other sexually transmitted diseases, HPV screening is not common practice in this country. To date, only a few studies have presented the different HPV types in cervical cancer patients; however, no study has reported the prevalence of HPV in a general, non-cancer population. Pakistan is densely populated and contributes significantly to world databases for infectious diseases. However, the epidemiology of HPV genotypes in Punjab Province has remained unclear, as no authentic data about the types and nature of the HPV prevalent in Pakistan are available. This study aimed to determine the status of HPV in a general Pakistani population residing in the Punjab region.
The data analysis showed that 4.74% (48/1011) of the subjects in the population assessed were infected with HPV, which is close to the result of another study from Pakistan (
), which reported an HPV prevalence of 2.8% in their study population in 2010. The incidence of HPV infections has shown an increasing trend over time, and furthermore the previous study was limited to the suburbs of Karachi, while the present study was conducted in patients from across various regions of Punjab. However, the HPV prevalence in the present study is lower than the previously reported worldwide prevalence of HPV in females with a normal cytology (i.e., 10%) (
Reduction in human papillomavirus (HPV) prevalence among young women following HPV vaccine introduction in the United States, National Health and Nutrition Examination Surveys 2003–2010.
). In 2005, Clifford et al. reported an HPV prevalence of 15.6% in Europe, 17% in India, 13–18% in Latin America, and 26% in Nigeria, as noted in cervical cancer screening programs. One possible reason for the low prevalence in the present study may be the customary monogamous behavior in the society of Pakistan.
The distribution of the different HPV genotypes varies significantly worldwide, due to the complex biological and geographical relationships among the various HPV types, as well as host immunogenetic factors. Overall, the study population had more LR-HPV types (33/1011, 3.26%) than HR-HPV types (15/1011, 1.48%); in contrast, other studies have reported HR-HPV to be more prevalent than LR-HPV (
Incidence and duration of type-specific human papillomavirus infection in high-risk HPV-naïve women: results from the control arm of a phase II HPV-16/18 vaccine trial.
), but these studies were conducted on cervical cancer patients.
The highest prevalence rates of HPV were found in the age groups 24–35 years (14/1011, 1.38%) and 35–45 years (20/1011, 1.97%), showing indirect proof of sexual transmission, as this group is sexually active. The probable reason for this transmission may be that the subjects or their male partners had multiple sexual partners. The decrease in incidence of HPV in the >45 years age group indicates an inverse relationship of the incidence of HPV and older age, as the >45 years age group is generally non-reproductive. These findings indicate that young sexually active females are at a high risk of developing HPV-related infections, as also reported by Ebrahim et al. (
), and moreover serve as proof of transient LR-HPV infections at an early age, which are less prone to develop into cancer. The results are consistent with those of a previous study (
Phylogenetically, all HPV types in this study showed 80–99% nucleotide identity with types related to the same species. Different HPV types in clusters 1–8 have co-evolved with the sequences from Asia, Africa, and Europe. This indicates the possible role of expatriates in the spread of STIs, as has been reported previously for HIV (
). The clustering of genotypes indicates that HPV types are separated taxonomically and the intra-typic variants also show only a limited degree of genome diversity.
In conclusion, the present study reports a 4.74% prevalence of various HPV types in women with a normal cytology residing in upper and lower Punjab. In a population with a normal cervical cytology, the prevalence of high-risk HPV types is very low. The most prevalent HPV genotype in Punjab Province of Pakistan was found to be low-risk HPV type 6, followed by HPV type 55. Sequencing of the partial L1 region suggested that this region was highly conserved in all reported sequences. The prevalence of HPV types in this study highlights the need for future studies to explore the determinants of HPV infection and associated risk factors, such as race and ethnicity, socio-economic status and income, marital status, sexual partners, education level, use of contraceptives, smoking etc., which have not been discussed previously. The data hold significance for the development of new HPV screening tests and for assessing the effects of future vaccines on infections of differing severity. The study also highlights the need to develop regular HPV screening so that the situation does not reach an alarming stage resulting in cervical cancer. Furthermore, the reliable and timely diagnosis of HR-HPV may also facilitate the early identification and prevention of cervical cancer in the region.
Funding
No external funding was provided.
Ethical approval
The study was approved by the ethics review boards of the Nuclear Medicine, Oncology and Radiotherapy Institute, International Islamic University, Islamabad (IIUI), and Pakistan Institute of Medical Science (PIMS).
Informed consent
Informed consent was obtained from each patient/relative of the patient for collection of the sample.
Conflict of interest
The authors declare no conflict of interest. All authors contributed equally to the design and writing of this article.
Acknowledgements
We are grateful to all the staff at MCH, PIMS Islamabad and Sheikh Zayed Hospital, Rahim Yar Khan for assisting in the collection of samples.
References
Abdullah A.
Qasim M.
Shafiq M.
Ijaz M.
Parveen S.
Murtaza S.
et al.
Molecular diagnosis and phylogenetic analysis of human papillomavirus type-16 from suspected patients in Pakistan.
Distribution of 37 mucosotropic HPV types in women with cytologically normal cervical smears: the age-related patterns for high-risk and low-risk types.
Reduction in human papillomavirus (HPV) prevalence among young women following HPV vaccine introduction in the United States, National Health and Nutrition Examination Surveys 2003–2010.
Incidence and duration of type-specific human papillomavirus infection in high-risk HPV-naïve women: results from the control arm of a phase II HPV-16/18 vaccine trial.
30291-6&id=gr1.jpg){kind=link}
30291-6&id=gr2.jpg){kind=link}
30291-6&id=gr3.jpg){kind=link}
30291-6&id=gr4.jpg){kind=link}
30291-6&id=gr5.jpg){kind=link}