Advertisement

Genetic variation in IL-10 influences the progression of hepatitis B infection

  • Magda Rybicka
    Correspondence
    Corresponding authors.
    Affiliations
    Department of Molecular Diagnostics, Intercollegiate Faculty of Biotechnology, University of Gdansk and Medical University of Gdansk, Abrahama 58, 80-307 Gdansk, Poland
    Search for articles by this author
  • Anna Woziwodzka
    Affiliations
    Department of Molecular Diagnostics, Intercollegiate Faculty of Biotechnology, University of Gdansk and Medical University of Gdansk, Abrahama 58, 80-307 Gdansk, Poland
    Search for articles by this author
  • Alicja Sznarkowska
    Affiliations
    Department of Molecular Diagnostics, Intercollegiate Faculty of Biotechnology, University of Gdansk and Medical University of Gdansk, Abrahama 58, 80-307 Gdansk, Poland

    International Centre for Cancer Vaccine Science, University of Gdansk, ul. Wita Stwosza 63, 80-308 Gdansk, Poland
    Search for articles by this author
  • Tomasz Romanowski
    Affiliations
    Department of Molecular Diagnostics, Intercollegiate Faculty of Biotechnology, University of Gdansk and Medical University of Gdansk, Abrahama 58, 80-307 Gdansk, Poland
    Search for articles by this author
  • Piotr Stalke
    Affiliations
    Department of Infectious Diseases, Medical University of Gdansk, ul. Powstania Styczniowego 9b, 81-519 Gdynia, Poland
    Search for articles by this author
  • Marcin Dręczewski
    Affiliations
    Department of Infectious Diseases, Medical University of Gdansk, ul. Powstania Styczniowego 9b, 81-519 Gdynia, Poland
    Search for articles by this author
  • Eloi R. Verrier
    Affiliations
    Université de Strasbourg, Inserm, Institut de Recherche sur les Maladies Virales et Hépatiques UMR_S1110, F-67000 Strasbourg, France
    Search for articles by this author
  • Thomas F. Baumert
    Affiliations
    Université de Strasbourg, Inserm, Institut de Recherche sur les Maladies Virales et Hépatiques UMR_S1110, F-67000 Strasbourg, France

    Pôle Hépato-Digestif, Institut Hospitalo-Universitaire, Hôpitaux Universitaires de Strasbourg, Strasbourg, France
    Search for articles by this author
  • Krzysztof Piotr Bielawski
    Correspondence
    Corresponding authors.
    Affiliations
    Department of Molecular Diagnostics, Intercollegiate Faculty of Biotechnology, University of Gdansk and Medical University of Gdansk, Abrahama 58, 80-307 Gdansk, Poland
    Search for articles by this author
Open AccessPublished:May 06, 2020DOI:https://doi.org/10.1016/j.ijid.2020.04.079

      Highlights

      • The host genetic background affects the outcomes of hepatitis B virus (HBV) infection.
      • Genetic variation in the interleukin 10 gene (IL10) is associated with treatment-induced hepatitis B surface antigen seroclearance.
      • The IL10 ATAC haplotype is more frequent in patients with less liver injury.
      • IL10 single-nucleotide polymorphisms influence on the chronicity of hepatitis B and virus-induced liver damage.

      Abstract

      Objectives

      The outcomes of hepatitis B virus (HBV) infection vary substantially among affected individuals, providing evidence of the role of host genetic background in the susceptibility to HBV persistence and the dynamics of liver injury progression to cirrhosis and hepatocellular carcinoma (HCC).

      Methods

      Six single-nucleotide polymorphisms within the interleukin 10 gene (IL10) were genotyped by MALDI-TOF mass spectrometry in 857 patients with chronic HBV infection (CHB), 48 patients with resolved HBV infection, and 100 healthy volunteers. Associations of the selected polymorphisms with susceptibility to chronic HBV infection, liver injury progression, and outcomes were investigated.

      Results

      IL10 −819T (rs1800871), −592A (rs1800872), and +504T (rs3024490) alleles were associated with treatment-induced hepatitis B surface antigen (HBsAg) seroclearance. Additionally, IL10 ATAC haplotype increased the chance of HBsAg loss and was significantly more frequent in patients with less liver injury. Moreover rs1800871TT, rs1518110TT, rs1800872AA, and rs3024490TT genotypes were identified as predictors of a lower FIB-4 score (<0.5).

      Conclusions

      This study indicates that polymorphisms within the promoter region and intronic sequences of IL10 are associated with chronicity of hepatitis B and with HBV-induced liver damage.

      Keywords

      Introduction

      Despite progress in implementing vaccination programmes and in the development of new treatment perspectives, hepatitis B virus (HBV) infections remain a major health problem worldwide, contributing considerably to cirrhosis- and hepatocellular carcinoma (HCC)-related mortality of 0.5–1 million per year. As much as one-third of the general population carries serological markers of HBV infection (
      • Hu P.
      • Ren H.
      Interpretations of EASL 2017 clinical practice guidelines on the management of hepatitis B virus infection.
      ).
      Outcomes of HBV infection vary substantially among affected individuals, providing evidence of the role of host genetic background in the susceptibility to HBV persistence and the dynamics of liver injury progression to cirrhosis and HCC. The response of the immune system to HBV infection is complex, and a broad range of cytokines such as interferon (IFN)-α/β, IFN-γ, and tumour necrosis factor (TNF)-α are involved in the early phase of infection. An effective antiviral response, mainly mediated by CD4+ and CD8+ T-cells, natural killer cells, and monocytes, may result in immune controlled HBV replication (functional cure). By contrast, in children and adults with a compromised immune system, active viral replication can become persistent. In chronic HBV infection, both the number of regulatory T-cells and levels of inhibitory interleukin 10 (IL-10) and transforming growth factor beta (TGF-β) increase, leading to HBV-specific CD8+ T-cell exhaustion and rendering viral eradication from the liver impossible (
      • Peeridogaheh H.
      • Meshkat Z.
      • Habibzadeh S.
      • Arzanlou M.
      • Shahi J.M.
      • Rostami S.
      • et al.
      Current concepts on immunopathogenesis of hepatitis B virus infection.
      ).
      IL-10 is recognized as a key cytokine regulating the immune response to HBV infection. Recently, a subset of IL-10-producing B-cells, known as regulatory B-cells (Bregs), have been shown to regulate HBV-specific CD8+ T-cell immunity (
      • Das A.
      • Ellis G.
      • Pallant C.
      • Lopes A.R.
      • Khanna P.
      • Peppa D.
      • et al.
      IL-10-producing regulatory B cells in the pathogenesis of chronic hepatitis B virus infection.
      ,
      • Liu Y.
      • Cheng L.-S.
      • Wu S.-D.
      • Wang S.-Q.
      • Li L.
      • She W.-M.
      • et al.
      IL-10-producing regulatory B-cells suppressed effector T-cells but enhanced regulatory T-cells in chronic HBV infection.
      ). Moreover, down-regulation of IL-10 restores the function of exhausted HBV-specific CD8+ T-cells (
      • Das A.
      • Ellis G.
      • Pallant C.
      • Lopes A.R.
      • Khanna P.
      • Peppa D.
      • et al.
      IL-10-producing regulatory B cells in the pathogenesis of chronic hepatitis B virus infection.
      ). In patients with chronic hepatitis B (CHB), both the levels of IL-10 and number of regulatory B-cells increase (
      • Das A.
      • Ellis G.
      • Pallant C.
      • Lopes A.R.
      • Khanna P.
      • Peppa D.
      • et al.
      IL-10-producing regulatory B cells in the pathogenesis of chronic hepatitis B virus infection.
      ). Serum IL-10 levels reflect the dynamics of viral load and liver inflammation, and are correlated with spontaneous flares of liver disease (
      • Das A.
      • Ellis G.
      • Pallant C.
      • Lopes A.R.
      • Khanna P.
      • Peppa D.
      • et al.
      IL-10-producing regulatory B cells in the pathogenesis of chronic hepatitis B virus infection.
      ). Moreover, IL-10 might substantially affect the antiviral immune response, as it inhibits the production of proinflammatory cytokines such as IFN-γ, TNF-α, IL-1β, and IL-6 (
      • Walter M.R.
      The molecular basis of IL-10 function: from receptor structure to the onset of signaling.
      ).
      The capacity for IL-10 production is regulated on the transcriptional level and is affected by single-nucleotide polymorphisms (SNPs) located in the 5′-flanking promoter region of the IL10 gene: −1082A/G (rs1800896), −819C/T (rs1800871), and −592C/A (rs1800872) (
      • Edwards-Smith C.J.
      • Jonsson J.R.
      • Purdie D.M.
      • Bansal A.
      • Shorthouse C.
      • Powell E.E.
      Interleukin-10 promoter polymorphism predicts initial response of chronic hepatitis C to interferon alfa.
      ,
      • Reuss E.
      • Fimmers R.
      • Kruger A.
      • Becker C.
      • Rittner C.
      • Höhler T.
      Differential regulation of interleukin-10 production by genetic and environmental factors — a twin study.
      ,
      • Höhler T.
      • Reuss E.
      • Freitag C.M.
      • Schneider P.M.
      A functional polymorphism in theIL-10 promoter influences the response after vaccination with HBsAg and hepatitis A.
      ). Numerous studies have aimed to elucidate the role of these SNPs in the anti-HBV response, and a recent meta-analysis conducted by Shu et al. confirmed their clinical significance in the course of HBV infection (
      • Shu C.
      • Wang J.
      • He Y.
      • Song T.
      • Chen Z.
      • Tang S.
      • et al.
      Effects of interleukin 10 polymorphisms on the development of hepatitis B virus infection: a systemic review and meta-analysis.
      ). Additionally, the −1353G/A (rs1800893) promoter and +954G/T (rs1518110) intronic IL10 SNPs have been shown to influence the outcome of HBV infection in African Americans (
      • Truelove A.L.
      • Oleksyk T.K.
      • Shrestha S.
      • Thio C.L.
      • Goedert J.J.
      • Donfield S.M.
      • et al.
      Evaluation of IL10, IL19, and IL20 gene polymorphisms and chronic hepatitis B infection outcome.
      ). Another IL10 intronic variant +504G/T (rs3024490) has been related to susceptibility to CHB in the Chinese Han population (
      • Zhang T.-C.
      • Zhang W.-F.
      • Zhao Y.-Q.
      • Pan F.-M.
      • Gao Y.-F.
      • Yuan H.
      • et al.
      Gene variation in IL10 and susceptibility to chronic hepatitis B.
      ).
      In CHB, activation of the immune response, required for virus eradication from hepatocytes, is also associated with inflammation that leads to liver damage. The host IL10 genetic background is a risk factor for liver injury and the development of cirrhosis in CHB (
      • Ghaleh Baghi S.
      • Alavian S.M.
      • Mehrnoush L.
      • Salimi S.
      Impact of the IL-10 promoter gene polymorphisms in the severity of chronic hepatitis B infection.
      ,
      • Guo P.-F.
      • Jin J.
      • Sun X.
      Influence of IL10 gene polymorphisms on the severity of liver fibrosis and susceptibility to liver cirrhosis in HBV/HCV-infected patients.
      ,
      • Yao L.
      • Xing S.
      • Fu X.
      • Song H.
      • Wang Z.
      • Tang J.
      • et al.
      Association between interleukin-10 gene promoter polymorphisms and susceptibility to liver cirrhosis.
      ). Interestingly, the role of IL-10 in liver disease is not limited to HBV-infected patients, and the interactions of the IL10 promoter genotype and liver outcome have also been observed in hepatitis C virus (HCV) infection (
      • Guo P.-F.
      • Jin J.
      • Sun X.
      Influence of IL10 gene polymorphisms on the severity of liver fibrosis and susceptibility to liver cirrhosis in HBV/HCV-infected patients.
      ) and alcohol-related cirrhosis (
      • Yang A.-M.
      • Wen L.-L.
      • Yang C.-S.
      • Wang S.-C.
      • Chen C.-S.
      • Bair M.-J.
      Interleukin 10 promoter haplotype is associated with alcoholic liver cirrhosis in Taiwanese patients.
      ). Indeed, there is evidence suggesting that IL-10, apart from its well-documented role in regulating the immune response to HBV infection, also exerts a modulatory effect in liver fibrogenesis (
      • Louis H.
      • Van Laethem J.-L.
      • Wu W.
      • Quertinmont E.
      • Degraef C.
      • Van den Berg K.
      • et al.
      Interleukin-10 controls neutrophilic infiltration, hepatocyte proliferation, and liver fibrosis induced by carbon tetrachloride in mice.
      ,
      • Thompson K.
      • Maltby J.
      • Fallowfield J.
      • McAulay M.
      • Millward-Sadler H.
      • Sheron N.
      Interleukin-10 expression and function in experimental murine liver inflammation and fibrosis.
      ).
      This study was performed to investigate the impact of four SNPs located in the promotor region of IL10 (rs1800896, rs1800871, rs1800872, rs1800893) and two IL10 intronic variants (rs1518110, rs3024490) on the course of CHB in a European population.

      Materials and methods

      Patients

      The study group consisted of 857 patients with CHB and 48 untreated patients in the hepatitis B surface antigen (HBsAg)-negative phase of disease (HBsAg-negative, hepatitis B core antibody (anti-HBc) reactive). The blood samples of 648 patients were collected from the ANRS CO22 HEPATHER cohort (ClinicalTrials.gov registry number NCT01953458). The remaining 257 CHB patients were recruited from the Department of Infectious Diseases, Medical University of Gdansk, and the Hepatology Outpatients Clinic of the Pomeranian Centre for Infectious Diseases and Tuberculosis in Gdansk in 2014–2016. The control group comprised 100 blood donors with confirmed absence of HIV, HBV, and HCV infections from the Gdansk Regional Centre of Blood Donations and Haemotherapy (Figure 1). Patients with a history of schistosomiasis infection, heavy alcohol abuse, non-alcoholic fatty liver disease (NAFLD), non-alcoholic steatohepatitis (NASH), or inherited liver diseases were excluded to prevent interference with the association with HBV infection.
      Blood tests, including hepatitis B serology (HBsAg, hepatitis B e antigen (HBeAg), hepatitis B e antibody (anti-HBe)) and the quantification of HBV DNA, were performed on all recruited patients. Liver biopsies were collected from 132 patients. The specimens were assessed for inflammation activity and stage of fibrosis according to Scheuer scores. For 725 patients, liver fibrosis or cirrhosis was assessed according to the Metavir scoring system, as described by
      • Carrat F.
      • Fontaine H.
      • Dorival C.
      • Simony M.
      • Diallo A.
      • Hezode C.
      • et al.
      Clinical outcomes in patients with chronic hepatitis C after direct-acting antiviral treatment: a prospective cohort study.
      . Significant fibrosis was defined as F ≥ 2 for the Metavir and Scheuer staging systems and cirrhosis was defined as F ≥ 4. The Fibrosis-4 score (FIB-4) (
      • Sterling R.K.
      • Lissen E.
      • Clumeck N.
      • Sola R.
      • Correa M.C.
      • Montaner J.
      • et al.
      Development of a simple noninvasive index to predict significant fibrosis in patients with HIV/HCV coinfection.
      ) and aspartate aminotransferase (AST)-to-platelet ratio index (APRI) (
      • Wai C.
      A simple noninvasive index can predict both significant fibrosis and cirrhosis in patients with chronic hepatitis C.
      ) were also used to estimate the amount of scarring in the liver.
      Of the 675 patients who received treatment according to Polish or French National Health Service recommendations, 99 (14.5%) were treated with pegylated interferon alpha (PEG-IFN-α), 502 (74.5%) with nucleoside/nucleotide analogues (NAs), and 74 (11%) with combination NA therapy. The treatment response was monitored by the measurement of HBV DNA and HBsAg loss at week 24 after treatment discontinuation for PEG-IFN-α-treated individuals, and at week 72 of treatment for NA-treated patients. At the 48-week follow-up, an analysis was conducted to further monitor HBsAg loss. Sustained virological response (SVR) was defined as an undetectable HBV DNA level at 24 weeks after treatment discontinuation.
      The study was performed with the approval of the local independent bioethics committee at the Medical University of Gdansk in compliance with the Declaration of Helsinki, and written consent was obtained from each patient.

      SNP genotyping

      Genomic DNA was isolated from the whole blood samples using the MagNA Pure Compact Nucleic Acid Isolation Kit I (Roche, Germany) according to the manufacturer’s protocol. The polymorphisms of the IL10 gene (−592C/A, rs1800872; −819C/T, rs1800871; −1082G/A, rs1800896; −1353C/T, rs1800893; +504G/T, rs3024490; +954G/T, rs1518110) were analysed by MassARRAY platform with iPLEX Pro chemistry (Agena Bioscience, USA) according to the standard protocol. Amplification and extension primers (Table 1) were designed with Agena Assay Design Suite v2. During the initial amplification PCR, six different products of ∼100 bp containing the SNPs of interest were amplified. Next, unincorporated dNTPs were removed with shrimp alkaline phosphatase. Finally, after single-nucleotide extension reaction, allele-specific products of distinct masses were obtained. The purified extension reaction products with an anion-exchange resin, were spotted onto SpectroCHIP using a MassARRAY RS1000 Nanodispenser. Mass spectra were acquired with a MassARRAY Analyzer 4 mass spectrometer and were analysed with MassARRAY Typer 4.0 software.
      Table 1Primers used for MALDI-TOF MassARRAY single-nucleotide polymorphism genotyping.
      NCBI IDPCR forward primer
      Each PCR primer also contained a 5′-ACGTTGGATG tag. 5′ tags on extension primers are marked in bold underline.
      PCR reverse primer
      Each PCR primer also contained a 5′-ACGTTGGATG tag. 5′ tags on extension primers are marked in bold underline.
      Extension primer
      rs1800871ATGCTAGTCAGGTAGTGCTCGGTGTACCCTTGTACAGGTGCCCCCTTGTACAGGTGATGTAA
      rs1800872AAAGGAGCCTGGAACACATCTCCTCAAAGTTCCCAAGCAGCAAGAGACTGGCTTCCTACAG
      rs1800893CTGACTATAGAGTGGCAGGCCTGCCATTCCAGTTTAGACTGTAACTGGGAGGAACA
      rs1800896GACAACACTACTAAGGCTTCATTCCATGGAGGCTGGATAGTTACCTATCCCTACTTCCCC
      rs1518110ATGCGGTCTTTTTGATGCCCTGATTTTTTTGGGCCAGAGCGGGCCAGAGCCAATTT
      rs3024490GGGAGCATCTTCACCTCGAACTTATAAGATCCTGCTGGCGGGCTAGGAGAAGTAAAGAAA
      MALDI-TOF, matrix-assisted laser desorption/ionization time-of-flight.
      a Each PCR primer also contained a 5′-ACGTTGGATG tag. 5′ tags on extension primers are marked in bold underline.

      Statistical analysis

      The statistical analysis was conducted using Statistica 13.3 (StatSoft, USA). MIDAS software was used to assess the linkage disequilibrium (LD) and deviations from Hardy–Weinberg equilibrium (HWE) of the analysed SNPs. The Chi-square test and Fisher’s exact test were applied to analyse the distribution of nominal variables. Haplotype blocks were constructed using HaploView 4.2 program. Quantitative variables were expressed as the median values (unless stated otherwise) and compared with the Mann–Whitney U-test or Kruskal–Wallis test. Logistic regression was conducted to determine the associations between analysed variables adjusted for possible confounders. All statistical tests were two-tailed. p-Values of less than 0.008 were considered significant after the Bonferroni correction was applied to account for multiple testing.

      Results

      Study group characteristics

      All enrolled individuals were unrelated Caucasian adults; 857 were patients with CHB, 48 were individuals who had recovered spontaneously from HBV infection (HBsAg-negative phase), constituting the functional cure control group, and 100 were volunteers, constituting the healthy control group. Their mean age was 52.0 years, 56.9 years, and 27.3 years, respectively. The baseline characteristics of the study and control groups are shown in Table 2.
      Table 2Baseline demographic and clinical characteristics of the study and control groups.
      CHB patients (n = 857)Individuals with functional cure (n = 48)Healthy controls (n = 100)
      Age, years51 ± 155.7 ± 1.427.3 ± 0.9
      Sex, % female37%30%22%
      Origin, % Caucasian100%100%100%
      ALT, IU/l97 ± 5329.50 ± 1.91
      AST, IU/l219 ± 9130.25 ± 2.83
      HBV DNA, kIU/ml6957 ± 1728
      HBsAg, % positive100%0%
      HBeAg, % positive13%
      Anti-HBsAg, % positive0%100%
      Anti-HBcAg, % positive100%100%
      Anti-HBe, % positive82%
      Liver inflammation grade
      Median value (25th–75th percentile).
      1.5 (0–2)
      Liver fibrosis stage
      Median value (25th–75th percentile).
      1 (0–2)0.62 (0–4)
      ALT, alanine aminotransferase; AST, aspartate aminotransferase; CHB, chronic hepatitis B; HBeAg, hepatitis B e antigen; HBsAg, hepatitis B surface antigen; HBV, hepatitis B virus. Data are reported as the mean ± standard error of the mean.
      a Median value (25th–75th percentile).
      The genotypes of six SNPs within IL10 were obtained for all 1005 subjects included in the study, with a success rate of 100%. All SNPs were variable in the study group. Genotypic and allelic frequencies of the analysed SNPs for the CHB and control groups are shown in Supplementary Material Table S1 and Table S2. For the control groups, the distribution of genotypes followed HWE (p > 0.05), except for rs1800871, rs1800872, and rs1518110 in individuals with functional cure. For CHB patients, the distributions were not consistent with HWE (p < 0.05). Significant differences in genotypic distribution of rs1800871, rs1800872, and rs151811 were found between healthy blood donors and individuals with HBsAg loss. Moreover, the genotypic distribution of rs1800893 differed between the CHB patients and the healthy control group (Supplementary MaterialTable S1). No statistically significant differences in allelic distribution of IL10 polymorphisms were observed between the CHB and the control groups (Supplementary MaterialTable S2).
      The haplotype analysis showed linkage disequilibrium between rs1800871 and rs1800872 (r2 = 0.88), rs1518110 (r2 = 0.74), and rs3024490 (r2 = 0.78); between rs1800893 and 1800896 (r2 = 0.89); between rs1518110 and rs1800872 (r2 = 0.68); and between rs1518110 and rs3024490 (r2 = 0.72). All remaining pairs of SNPs were independent (r2 < 0.2).
      In this study, rs1800896CC and rs1800893CC genotypes were more common in patients with lower baseline HBV DNA levels (<2000 IU/ml) (sex-adjusted GG, GA vs. AA: odds ratio (OR) 1.72, 95% confidence interval (CI) 1.16–2.57, p = 0.007; sex-adjusted TT, CT vs. CC: OR 1.82, 95% CI 1.22–2.70, p = 0.003).

      IL10 polymorphisms and treatment response

      For the CHB patients who underwent antiviral treatment, an analysis was performed to determine whether the IL10 polymorphisms affected the treatment response expressed as HBsAg clearance. Three of the analysed polymorphisms within IL10 were significantly associated with treatment-induced HBsAg loss at 24 weeks after discontinuation of PEG-IFN-α. Significantly higher minor allele frequencies at −819T (rs1800871), −592A (rs1800872), and +504T (rs3024490) were observed in patients with HBsAg loss (Table 3). In the group of patients previously treated with NAs, rs1800896 was associated with a higher predisposition to treatment-induced loss of HBsAg (age and sex-adjusted: OR 0.037, 95% CI 0.002–0.66, p = 0.01); however significance was lost after Bonferroni correction. Additionally, the IL10 ATAC haplotype (−1082A/−819T/−592A/−1353C) increased the chance of achieving the HBsAg-negative phase in the PEG-IFN-α-treated (sex and age-adjusted: OR 9.85, 95% CI 1.13–85, p = 0.0034) and NA-treated (sex and age-adjusted: OR 20.33, 95% CI 3.25–127, p = 0.0012) groups.
      Table 3IL10 polymorphisms and chance of PEG-IFN-α-induced HBsAg loss.
      Multivariate logistic regression analysis adjusted for age; HBsAg loss defined as HBsAg negativity at week 24 after treatment discontinuation.
      IL10 genotypeMAFOdds ratio95% CIp-Value
      rs1800896 [A/G]
       AA vs. GAG = 0.270.430.15–1.270.12
       AA vs. GG0.190.02–1.610.10
      rs1800871 [C/T]
       CC vs. CTT = 0.434.431.33–14.760.016
      Multivariate logistic regression analysis adjusted for age; HBsAg loss defined as HBsAg negativity at week 24 after treatment discontinuation.
       CC vs. TT19.591.76–2170.0068
      Significant p-values (p < 0.05); those marked with an asterisk (*) remained significant after Bonferroni correction.
      *
      rs1800872 [C/A]
       CC vs. CAA = 0.393.601.31–9.890.013
      Multivariate logistic regression analysis adjusted for age; HBsAg loss defined as HBsAg negativity at week 24 after treatment discontinuation.
       CC vs. AA12.971.72–970.007
      Significant p-values (p < 0.05); those marked with an asterisk (*) remained significant after Bonferroni correction.
      *
      rs1800893 [G/A]
       CC vs. CTT = 0.280.420.15–1.260.12
       CC vs. TT0.190.022–1.620.10
      rs3024490 [G/T]
       GG vs. GTT = 0.433.671.35–100.012
      Multivariate logistic regression analysis adjusted for age; HBsAg loss defined as HBsAg negativity at week 24 after treatment discontinuation.
       GG vs. TT13.461.81–1000.009
      Significant p-values (p < 0.05); those marked with an asterisk (*) remained significant after Bonferroni correction.
      *
      rs1518110 [G/T]
       GG vs. GTT = 0.421.540.66–3.630.31
       GG vs. TT2.390.43–13.180.31
      CI, confidence interval; HBsAg, hepatitis B surface antigen; IL10, interleukin 10 gene; PEG-IFN-α, pegylated interferon alpha; MAF, minor allele frequency.
      a Multivariate logistic regression analysis adjusted for age; HBsAg loss defined as HBsAg negativity at week 24 after treatment discontinuation.
      b Significant p-values (p < 0.05); those marked with an asterisk (*) remained significant after Bonferroni correction.
      The incidence of HBsAg loss was assessed in 344 patients from the original cohort of 675 CHB patients who underwent antiviral treatment, and the clearance rate was found to be 6.98%. Comparison of the genotype and allele frequencies between individuals with and without treatment-induced loss of HBsAg revealed significant differences in all six polymorphisms within IL10 (Table 4).
      Table 4Genotypic and allelic distribution of analysed IL10 polymorphisms between CHB patients (HBsAg-positive) and individuals who achieved HBsAg loss induced by antiviral treatment (HBsAg-negative).
      SNP IDGenotypic distribution (%)Allelic distribution (%)
      GenotypeHBsAg (+) (n = 320)HBsAg (−) (n = 24)p-ValueAlleleHBsAg (+) (n = 640)HBsAg (−) (n = 48)p-Value
      −592C/A (rs1800872)CC185 (58)6 (25)C471 (74)22 (46)
      CA101 (31)10 (42)0.0007
      Significant p-values (p < 0.05).
      A169 (26)26 (54)0.000039
      Significant p-values (p < 0.05).
      AA34 (11)8 (33)
      −819C/T (rs1800871)CC182 (57)6 (25)C470 (73.5)22 (46)
      CT106 (33)10 (42)0.0005
      Significant p-values (p < 0.05).
      T170 (26.5)26 (54)0.000044
      Significant p-values (p < 0.05).
      TT32 (10)8 (33)
      −1082G/A (rs1800896)GG61 (19)1 (4)G263 (41)10 (21)
      GA141 (44)8 (33)0.03
      Significant p-values (p < 0.05).
      A377 (59)38 (79)0.005653
      Significant p-values (p < 0.05).
      AA118 (37)15 (63)
      −1353C/T (rs1800893)CC122 (38)14 (58)C363 (57)37 (77)
      CT119 (37)9 (38)0.041
      Significant p-values (p < 0.05).
      T277 (43)11 (23)0.005809
      Significant p-values (p < 0.05).
      TT79 (25)1 (4)
      +504G/T (rs3024490)GG173 (54)7 (29)G462 (72)24 (50)
      GT116 (36.5)10 (42)0.005
      Significant p-values (p < 0.05).
      T178 (28)24 (50)0.001132
      Significant p-values (p < 0.05).
      TT31 (9.5)7 (29)
      +954G/T (rs1518110)GG188 (59)12 (50)G476 (74.5)28 (58)
      GT100 (31)4 (17)0.0021
      Significant p-values (p < 0.05).
      T164 (25.5)20 (42)0.015446
      Significant p-values (p < 0.05).
      TT32 (10)8 (33)
      CHB, chronic hepatitis B; HBsAg, hepatitis B surface antigen; HBsAg (+), HBsAg-positive patients; HBsAg (−), HBsAg-negative patients; IL10, interleukin 10 gene; SNP, single nucleotide polymorphism.
      a Significant p-values (p < 0.05).

      IL10 polymorphisms and liver injury

      To examine possible risk factors for liver injury assessed by FIB-4 in the study population, logistic regression analyses were conducted on variables that were IL10 genotypes, sex, and age. In the multivariate analysis rs1800871TT, rs1518110TT, rs1800872AA, and rs3024490TT genotypes were identified as predictors of a lower FIB-4 score (p < 0.5) (Table 5). Similar observations were found for the APRI index results, which were significantly lower in patients with a homozygosity of the minor allele within these four SNPs in the IL10 gene (p = 0.003). Additionally, the IL10 gene ATAC haplotype (−1082A/−819T/−592A/−1353C) was significantly more frequent in patients with less liver injury (OR 8.94, 95% CI 1.78–44, p = 0.007). Moreover, the IL10 GCCT haplotype (−1082G/−819C/−592C/−1353T) increased the risk of developing cirrhosis (OR 2.61, 95% CI 1.58–4.30, p = 0.0003).
      Table 5Relationship between IL10 polymorphisms and severity of liver disease in HBV-infected patients.
      Liver fibrosis was assessed by the FIB-4 index.
      IL10 genotypeMAFOdds ratio95% CIp-Value
      rs1800871 [C/T]
       CC,CT vs. TTT = 0.438.941.78–44.800.007
      Significant p-values (p < 0.05); those marked with an asterisk (*) remained significant after Bonferroni correction.
      *
      rs1800872 [C/A]
       CC,CA vs. AAA = 0.399.151.82–45.890.006
      Significant p-values (p < 0.05); those marked with an asterisk (*) remained significant after Bonferroni correction.
      *
      rs3024490 [G/T]
       GG,GT vs. TTT = 0.439.021.79–450.007
      Significant p-values (p < 0.05); those marked with an asterisk (*) remained significant after Bonferroni correction.
      *
      rs1518110 [G/T]
       GG,GT vs. TTT = 0.428.841.76–44.290.008
      Significant p-values (p < 0.05); those marked with an asterisk (*) remained significant after Bonferroni correction.
      *
      CI, confidence interval; HBV, hepatitis B virus; IL10, interleukin 10 gene; MAF, minor allele frequency.
      a Liver fibrosis was assessed by the FIB-4 index.
      b Significant p-values (p < 0.05); those marked with an asterisk (*) remained significant after Bonferroni correction.

      Discussion

      In its key role, IL-10 acts as an immunosuppressive cytokine by suppressing T-cell proliferation and antigen-presenting cell (APC) functions, and by modulating cytokine and chemokine synthesis (
      • Saraiva M.
      • O’Garra A.
      The regulation of IL-10 production by immune cells.
      ). IL10 expression is elevated during several chronic viral infections, which serves as a viral strategy to downregulate the host immune response and allow viral persistence in the host (
      • Hyodo N.
      • Nakamura I.
      • Imawari M.
      Hepatitis B core antigen stimulates interleukin-10 secretion by both T cells and monocytes from peripheral blood of patients with chronic hepatitis B virus infection.
      ,
      • Ohga S.
      • Nomura A.
      • Takada H.
      • Tanaka T.
      • Furuno K.
      • Takahata Y.
      • et al.
      Dominant expression of interleukin-10 and transforming growth factor-β genes in activated T-cells of chronic active epstein-barr virus infection.
      ,
      • Brooks D.G.
      • Trifilo M.J.
      • Edelmann K.H.
      • Teyton L.
      • McGavern D.B.
      • Oldstone M.B.A.
      Interleukin-10 determines viral clearance or persistence in vivo.
      ,
      • Kaplan D.E.
      • Ikeda F.
      • Li Y.
      • Nakamoto N.
      • Ganesan S.
      • Valiga M.E.
      • et al.
      Peripheral virus-specific T-cell interleukin-10 responses develop early in acute hepatitis C infection and become dominant in chronic hepatitis.
      ,
      • Brockman M.A.
      • Kwon D.S.
      • Tighe D.P.
      • Pavlik D.F.
      • Rosato P.C.
      • Sela J.
      • et al.
      IL-10 is up-regulated in multiple cell types during viremic HIV infection and reversibly inhibits virus-specific T cells.
      ). Over recent years it has been established that polymorphism within the IL10 promoter region influences expression and serum levels of IL-10. Three functional SNPs in the IL10 promoter have been investigated intensively: 1082A/G, −819T/C, and −592A/C. These SNPs present three major haplotypes: ATA, ACC, and GCC, which are associated with low, medium, and high levels of IL10 expression, respectively (
      • Turner D.M.
      • Williams D.M.
      • Sankaran D.
      • Lazarus M.
      • Sinnott P.J.
      • Hutchinson I.V.
      An investigation of polymorphism in the interleukin-10 gene promoter.
      ,
      • Eskdale J.
      • Gallagher G.
      • Verweij C.L.
      • Keijsers V.
      • Westendorp R.G.J.
      • Huizinga T.W.J.
      Interleukin 10 secretion in relation to human IL-10 locus haplotypes.
      ). These three polymorphisms have been demonstrated to be essential modulators of the immune response against hepatitis viral antigens, suggesting their role in the aetiology of HBV infection (
      • Höhler T.
      • Reuss E.
      • Freitag C.M.
      • Schneider P.M.
      A functional polymorphism in theIL-10 promoter influences the response after vaccination with HBsAg and hepatitis A.
      ).
      In this study, six common polymorphisms in the IL10 gene (four from the promoter region and two intronic variants) were genotyped in a cohort of HBV chronically infected patients, a group of individuals in the HBsAg-negative phase, and in healthy blood donors. Differences in genotype distribution in one SNP (rs1800893) between CHB patients and healthy blood donors, and in three SNPs (rs1800871, rs1800872, rs1518110) between healthy blood donors and individuals in the HBsAg-negative phase of HBV infection, were observed. Strikingly, all of the analysed SNPs showed significantly different genotypic and allelic distributions between chronically infected patients and the spontaneously recovered group.
      • Hyodo N.
      • Nakamura I.
      • Imawari M.
      Hepatitis B core antigen stimulates interleukin-10 secretion by both T cells and monocytes from peripheral blood of patients with chronic hepatitis B virus infection.
      ) showed that IL-10 production is elevated in response to the HBV core antigen (HBcAg) in patients with chronic infection, suggesting that its excessive production may contribute to HBV persistency in these patients (
      • Hyodo N.
      • Nakamura I.
      • Imawari M.
      Hepatitis B core antigen stimulates interleukin-10 secretion by both T cells and monocytes from peripheral blood of patients with chronic hepatitis B virus infection.
      ). Knowing that all of the analysed SNPs are associated with the IL10 expression level, it is justified to conclude that IL10 polymorphisms play an essential role in the immune response against HBV infection.
      As well as determining the possible association of IL10 polymorphisms with the chronicity of HBV infection, this study also investigated whether these could have a predictive value in assessing the response of CHB patients to antiviral therapy (IFN-α and analogues) measured by serum HBsAg loss. In this study, three of the IL10 treatment response to PEG-IFN-α, and it was determined that the ATAC haplotype increased the chance of treatment-induced HBsAg loss. The ATA haplotype has already been correlated with a low level of IL10 expression. ATA individuals secrete on average two or three times less IL-10 than GCC individuals (
      • Turner D.M.
      • Williams D.M.
      • Sankaran D.
      • Lazarus M.
      • Sinnott P.J.
      • Hutchinson I.V.
      An investigation of polymorphism in the interleukin-10 gene promoter.
      ). Heterogeneity in the promoter region of the IL10 gene affects the initial response to IFN-α therapy in patients with hepatitis C. Patients who are genetically predisposed to high IL-10 production have shown a poor response to IFN-α. A better response to treatment has also been associated with lower liver fibrosis. Similarly in the present study, alleles that were related to treatment-induced HBV loss were associated with a decreased liver fibrosis scored by FIB-4 and APRI indexes. This indicates that IL10 polymorphisms might have a prognostic value in assessing the liver condition in chronically infected patients. Moreover, the ATAC haplotype, which was associated with a decreased IL10 expression and an increased chance of eliminating viral infection, was more often found in patients with less intense liver injury. In contrast, the GCCT haplotype, associated with high IL10 expression, has been shown to increase the risk of progression to cirrhosis (
      • Shin H.D.
      Interleukin 10 haplotype associated with increased risk of hepatocellular carcinoma.
      ). This proves that IL10 polymorphisms may not only impact the antiviral immune response, but also HBV infection-induced liver fibrosis. In studies on alcohol-induced liver cirrhosis, it was the low expression of the ATA haplotype that was associated with increased fibrosis and a higher risk of alcoholic cirrhosis in Taiwanese patients (
      • Yang A.-M.
      • Wen L.-L.
      • Yang C.-S.
      • Wang S.-C.
      • Chen C.-S.
      • Bair M.-J.
      Interleukin 10 promoter haplotype is associated with alcoholic liver cirrhosis in Taiwanese patients.
      ). IL-10 has been shown to protect against inflammation-induced liver damage, fibrosis, and cirrhosis due to its immunosuppressive action (
      • Thompson K.
      • Maltby J.
      • Fallowfield J.
      • McAulay M.
      • Millward-Sadler H.
      • Sheron N.
      Interleukin-10 expression and function in experimental murine liver inflammation and fibrosis.
      ). Interestingly, in the present study the ATAC haplotype was found to be associated with a better liver condition and less fibrosis in chronically infected patients. This leads to the conclusion that lower levels of IL-10 allow the virus to be eradicated more quickly and more effectively, and in this way protect the liver from the virus-induced fibrosis.
      What emerges from this study is that polymorphisms within the promoter region and intronic sequences of IL10 are strongly associated with chronicity of hepatitis B and with the virus-induced liver damage.
      This study has some limitations. The influence of the particular polymorphisms on IL10 expression was not analysed. However, in terms of the SNPs localized in the promoter region, there are many studies pointing to their impact on IL10 expression (through the modulation of the transcription factor binding sites), although we do not know how the intronic variants affect the IL-10 level and/or activity. It can only be hypothesized that intronic SNPs affect splicing and therefore modulate IL10 mRNA levels or stability, but this hypothesis awaits verification.

      Funding

      This work was supported by the National Centre for Research and Development (NCBR, grant number INFECT-ERA/01/2014) and by the French National Research Agency (ANR, grant number ANR-13-IFEC-0006-02) in the frame of the European consortium Infect-ERA hepBccc and ST79 from the Medical University of Gdansk, and the MOBI4Health project, which is funded by the European Union’s Seventh Framework Programme under grant agreement number 316094.

      Conflict of interest

      None to declare.

      Acknowledgements

      We thank the participants and participating clinicians of the ANRS CO22 HEPATHER cohort at each study site. We thank F. Carrat, S. Pol, and H. Fontaine, the coordinators of the cohort, C. Dorival, project manager, and the ANRS CO22 HEPATHER scientific committee. The ANRS CO22 HEPATHER cohort is sponsored and funded by Inserm‐ANRS (France Recherche Nord & Sud Sida‐vih Hepatites), ANR (Agence Nationale de la Recherche), DGS(Direction Générale de la Santé), and MSD,Janssen,Gilead,AbbVie,BMS andRoche.

      Appendix A. Supplementary data

      The following is Supplementary data to this article:

      References

        • Brockman M.A.
        • Kwon D.S.
        • Tighe D.P.
        • Pavlik D.F.
        • Rosato P.C.
        • Sela J.
        • et al.
        IL-10 is up-regulated in multiple cell types during viremic HIV infection and reversibly inhibits virus-specific T cells.
        Blood. 2009; 114 ([Cited 18 August 2019]. Available from:): 346-356
        • Brooks D.G.
        • Trifilo M.J.
        • Edelmann K.H.
        • Teyton L.
        • McGavern D.B.
        • Oldstone M.B.A.
        Interleukin-10 determines viral clearance or persistence in vivo.
        Nat Med. 2006; 12 ([Cited 18 August 2019]. Available from:): 1301-1309
        • Carrat F.
        • Fontaine H.
        • Dorival C.
        • Simony M.
        • Diallo A.
        • Hezode C.
        • et al.
        Clinical outcomes in patients with chronic hepatitis C after direct-acting antiviral treatment: a prospective cohort study.
        Lancet. 2019; 393 ([Cited 29 September 2019]. Available from:): 1453-1464
        • Das A.
        • Ellis G.
        • Pallant C.
        • Lopes A.R.
        • Khanna P.
        • Peppa D.
        • et al.
        IL-10-producing regulatory B cells in the pathogenesis of chronic hepatitis B virus infection.
        J Immunol. 2012; 189 ([Cited 15 April 2019]. Available from:): 3925-3935
        • Edwards-Smith C.J.
        • Jonsson J.R.
        • Purdie D.M.
        • Bansal A.
        • Shorthouse C.
        • Powell E.E.
        Interleukin-10 promoter polymorphism predicts initial response of chronic hepatitis C to interferon alfa.
        Hepatology. 1999; 30 ([Cited 15 April 2019]. Available from:): 526-530
        • Eskdale J.
        • Gallagher G.
        • Verweij C.L.
        • Keijsers V.
        • Westendorp R.G.J.
        • Huizinga T.W.J.
        Interleukin 10 secretion in relation to human IL-10 locus haplotypes.
        Proc Natl Acad Sci. 1998; 95 ([Cited 18 August 2019]. Available from:): 9465-9470
        • Ghaleh Baghi S.
        • Alavian S.M.
        • Mehrnoush L.
        • Salimi S.
        Impact of the IL-10 promoter gene polymorphisms in the severity of chronic hepatitis B infection.
        Hepat Mon. 2015; 15 ([Cited 17 April 2019]. Available from:)
        • Guo P.-F.
        • Jin J.
        • Sun X.
        Influence of IL10 gene polymorphisms on the severity of liver fibrosis and susceptibility to liver cirrhosis in HBV/HCV-infected patients.
        Infect Genet Evol. 2015; 30 ([Cited 17 April 2019]. Available from:): 89-95
        • Höhler T.
        • Reuss E.
        • Freitag C.M.
        • Schneider P.M.
        A functional polymorphism in theIL-10 promoter influences the response after vaccination with HBsAg and hepatitis A.
        Hepatology. 2005; 42 ([Cited 15 April 2019]. Available from:): 72-76
        • Hu P.
        • Ren H.
        Interpretations of EASL 2017 clinical practice guidelines on the management of hepatitis B virus infection.
        Zhonghua Gan Zang Bing Za Zhi. 2017; 25 ([Cited 11 October 2019]. Available from:): 415-418
        • Hyodo N.
        • Nakamura I.
        • Imawari M.
        Hepatitis B core antigen stimulates interleukin-10 secretion by both T cells and monocytes from peripheral blood of patients with chronic hepatitis B virus infection.
        Clin Exp Immunol. 2004; 135 ([Cited 18 August 2019]. Available from:): 462-466
        • Kaplan D.E.
        • Ikeda F.
        • Li Y.
        • Nakamoto N.
        • Ganesan S.
        • Valiga M.E.
        • et al.
        Peripheral virus-specific T-cell interleukin-10 responses develop early in acute hepatitis C infection and become dominant in chronic hepatitis.
        J Hepatol. 2008; 48 ([Cited 18 August 2019]. Available from:): 903-913
        • Liu Y.
        • Cheng L.-S.
        • Wu S.-D.
        • Wang S.-Q.
        • Li L.
        • She W.-M.
        • et al.
        IL-10-producing regulatory B-cells suppressed effector T-cells but enhanced regulatory T-cells in chronic HBV infection.
        Clin Sci. 2016; 130 ([Cited 15 April 2019]. Available from:): 907-919
        • Louis H.
        • Van Laethem J.-L.
        • Wu W.
        • Quertinmont E.
        • Degraef C.
        • Van den Berg K.
        • et al.
        Interleukin-10 controls neutrophilic infiltration, hepatocyte proliferation, and liver fibrosis induced by carbon tetrachloride in mice.
        Hepatology. 1998; 28 ([Cited 17 April 2019]. Available from:): 1607-1615
        • Ohga S.
        • Nomura A.
        • Takada H.
        • Tanaka T.
        • Furuno K.
        • Takahata Y.
        • et al.
        Dominant expression of interleukin-10 and transforming growth factor-β genes in activated T-cells of chronic active epstein-barr virus infection.
        J Med Virol. 2004; 74 ([Cited 18 August 2019]. Available from:): 449-458
        • Peeridogaheh H.
        • Meshkat Z.
        • Habibzadeh S.
        • Arzanlou M.
        • Shahi J.M.
        • Rostami S.
        • et al.
        Current concepts on immunopathogenesis of hepatitis B virus infection.
        Virus Res. 2018; 245 ([Cited 10 April 2019]. Available from:): 29-43
        • Reuss E.
        • Fimmers R.
        • Kruger A.
        • Becker C.
        • Rittner C.
        • Höhler T.
        Differential regulation of interleukin-10 production by genetic and environmental factors — a twin study.
        Genes Immun. 2002; 3 ([Cited 15 April 2019]. Available from:): 407-413
        • Saraiva M.
        • O’Garra A.
        The regulation of IL-10 production by immune cells.
        Nat Rev Immunol. 2010; 10 ([Cited 18 August 2019]. Available from:): 170-181
        • Shin H.D.
        Interleukin 10 haplotype associated with increased risk of hepatocellular carcinoma.
        Hum Mol Genet. 2003; 12 ([Cited 6 September 2019]. Available from:): 901-906
        • Shu C.
        • Wang J.
        • He Y.
        • Song T.
        • Chen Z.
        • Tang S.
        • et al.
        Effects of interleukin 10 polymorphisms on the development of hepatitis B virus infection: a systemic review and meta-analysis.
        Int J Clin Exp Med. 2015; 8 ([Cited 10 April 2019]. Available from:): 12028-12040
        • Sterling R.K.
        • Lissen E.
        • Clumeck N.
        • Sola R.
        • Correa M.C.
        • Montaner J.
        • et al.
        Development of a simple noninvasive index to predict significant fibrosis in patients with HIV/HCV coinfection.
        Hepatology. 2006; 43 ([Cited 7 May 2019]. Available from:): 1317-1325
        • Thompson K.
        • Maltby J.
        • Fallowfield J.
        • McAulay M.
        • Millward-Sadler H.
        • Sheron N.
        Interleukin-10 expression and function in experimental murine liver inflammation and fibrosis.
        Hepatology. 1998; 28 ([Cited 17 April 2019]. Available from:): 1597-1606
        • Truelove A.L.
        • Oleksyk T.K.
        • Shrestha S.
        • Thio C.L.
        • Goedert J.J.
        • Donfield S.M.
        • et al.
        Evaluation of IL10, IL19, and IL20 gene polymorphisms and chronic hepatitis B infection outcome.
        Int J Immunogenet. 2008; 35 ([Cited 15 April 2019]. Available from:): 255
        • Turner D.M.
        • Williams D.M.
        • Sankaran D.
        • Lazarus M.
        • Sinnott P.J.
        • Hutchinson I.V.
        An investigation of polymorphism in the interleukin-10 gene promoter.
        Eur J Immunogenet. 1997; 24 ([Cited 18 August 2019]. Available from:): 1-8
        • Wai C.
        A simple noninvasive index can predict both significant fibrosis and cirrhosis in patients with chronic hepatitis C.
        Hepatology. 2003; 38 ([Cited 7 May 2019] Available from:): 518-526
        • Walter M.R.
        The molecular basis of IL-10 function: from receptor structure to the onset of signaling.
        Curr Top Microbiol Immunol. 2014; 380 ([Cited 15 April 2019]. Available from:): 191-212
        • Yang A.-M.
        • Wen L.-L.
        • Yang C.-S.
        • Wang S.-C.
        • Chen C.-S.
        • Bair M.-J.
        Interleukin 10 promoter haplotype is associated with alcoholic liver cirrhosis in Taiwanese patients.
        Kaohsiung J Med Sci. 2014; 30 ([Cited 17 April 2019]. Available from:): 291-298
        • Yao L.
        • Xing S.
        • Fu X.
        • Song H.
        • Wang Z.
        • Tang J.
        • et al.
        Association between interleukin-10 gene promoter polymorphisms and susceptibility to liver cirrhosis.
        Int J Clin Exp Pathol. 2015; 8 ([Cited 10 April 2019]. Available from:): 11680
        • Zhang T.-C.
        • Zhang W.-F.
        • Zhao Y.-Q.
        • Pan F.-M.
        • Gao Y.-F.
        • Yuan H.
        • et al.
        Gene variation in IL10 and susceptibility to chronic hepatitis B.
        J Infect. 2014; 69 ([Cited 15 April 2019]. Available from:): 75-80