Advertisement

Subpatent Plasmodium with mutant pfmdr1, pfcrt, and pvmdr1 alleles from endemic provinces in Mindanao, the Philippines: implications for local malaria elimination

Open AccessPublished:June 19, 2021DOI:https://doi.org/10.1016/j.ijid.2021.06.033
      • A total of 142 Plasmodium spp infections were detected by PCR, all but two of which were asymptomatic.
      • The results showed poor diagnostic accuracy of microscopy and RDT for the detection of asymptomatic malaria.
      • There was a higher prevalence of P. vivax than expected, based on figures for Mindanao.
      • Drug-resistant gene alleles occurred in both P. falciparum and P. vivax.

      Abstract

      Objectives

      This study was performed to identify and characterize circulating Plasmodium species in three provinces of Mindanao approaching malaria elimination.

      Methods

      Rapid diagnostic tests (RDT), microscopic examination, and PCR were used to detect malaria parasites. PCR-positive isolates were genotyped for polymorphisms in loci of interest.

      Results

      A total of 2639 participants were surveyed in Mindanao between 2010 and 2013. Malaria prevalence by PCR was 3.8% (95% confidence interval (CI): 2.7–5.2%) in Sarangani, 10% (95% CI: 7.7–12.7%) in South Cotabato, and 4.2% (95% CI: 3.2–5.6%) in Tawi-Tawi. P. falciparum and P. vivax were identified in all three provinces, and there was one case of P. malariae in South Cotabato. RDT was inferior to PCR for detecting asymptomatic P. falciparum and P. vivax. In Tawi-Tawi, microscopy failed to identify 46 PCR-positive malaria infections. The presence of pfcrt haplotypes CVMNK, CVIET, and SMNT (codons 72–76), pfmdr1 haplotype NFSND (codons 86, 184, 1034, 1042, 1246), and pvmdr1 haplotype NFL (codons 91, 976, 1076) was confirmed in Mindanao.

      Conclusions

      Asymptomatic Plasmodium infections persisted in local communities between 2010 and 2013. PCR successfully identified subpatent malaria infections, and can better characterize malaria epidemiology in communities seeking malaria control and elimination at the local level.

      KEYWORDS

      1. Introduction

      To achieve the goal of malaria elimination by 2030, the Department of Health (DOH) in the Philippines is following a devolved malaria elimination strategy in all endemic provinces (
      • Espino F
      • Beltran M
      • Carisma B.
      Malaria control through municipalities in the Philippines: struggling with the mandate of decentralized health programme management.
      ). The Philippines scaled up vector control and has deployed artemether–lumefantrine (AL) with primaquine (PQ) as the first-line treatment for Plasmodium falciparum since 2009. Chloroquine (CQ) and PQ remained the approved regimen for treating Plasmodium vivax malaria. These measures resulted in an 80% reduction in malaria cases, with 27 provinces declared malaria-free in 2013 (
      Department of Health Philippines
      Malaria Medium Term Development Plan 2011-2016.
      ,

      The Global Health Group, Eliminating malaria in the Philippines, Allison Phillips, Editor. 2013; UCSF Global Health Sciences: San Francisco. p. 1-6.

      ). By 2019, 42 of the country's 81 provinces, including South Cotabato in Mindanao, had been declared malaria-free. The Philippines is aiming to further reduce local malaria incidence by 90% in 2022 and has moved its target year for malaria elimination from 2020 to 2030 (
      • Cortez GM.
      DoH targets a malaria-free PHL by 2030.
      ,
      • Wen S
      • Harvard KE
      • Gueye CS
      • Canavati SE
      • Chancellor A
      • Ahmed BN
      • et al.
      Targeting populations at higher risk for malaria: a survey of national malaria elimination programmes in the Asia Pacific.
      ).
      Challenges for elimination in the Philippines include that strategies aimed at eliminating P. falciparum may not reduce P. vivax transmission, sustained by relapse of hepatic hypnozoite stages, the lack of information on the distribution of P. falciparum and P. vivax in the remaining endemic provinces of Mindanao, where political instability can threaten programme security, and inadequate data on Plasmodium malariae, Plasmodium ovale spp., and Plasmodium knowlesi. The latter species has been reported on Palawan Island and recent information suggests its public health impact in that province has been underestimated (
      • Luchavez J
      • Espino F
      • Curameng P
      • Espina R
      • Bell D
      • Chiodini P
      • et al.
      Human Infections with Plasmodium knowlesi, the Philippines.
      ,
      • Fornace KM
      • Herman LS
      • Abidin TR
      • Chua TH
      • Daim S
      • Lorenzo PJ
      • et al.
      Exposure and infection to Plasmodium knowlesi in case study communities in Northern Sabah, Malaysia and Palawan, The Philippines.
      ). P. knowlesi has not been investigated in Mindanao. Finally, there is limited knowledge of the prevalence of variant alleles of the P. falciparum and P. vivax chloroquine resistance transporter (crt) and multidrug resistance (mdr1) genes in Mindanao. These variants may limit the efficacy of currently used antimalarials in the country (
      • Chen N
      • Wilson DW
      • Pasay C
      • Bell D
      • Martin LB
      • Kyle D
      • Cheng Q.
      Origin and dissemination of chloroquine-resistant Plasmodium falciparum with mutant pfcrt alleles in the Philippines.
      ,
      • Chen N
      • Kyle DE
      • Pasay C
      • Fowler EV
      • Baker J
      • Peters JM
      • et al.
      pfcrt Allelic types with two novel amino acid mutations in chloroquine-resistant Plasmodium falciparum isolates from the Philippines.
      ,
      • Hatabu T
      • Kawazu S
      • Suzuki J
      • Valenzuela RF
      • Villacorte EA
      • Suzuki M
      • et al.
      In vitro susceptibility of Plasmodium falciparum isolates to chloroquine and mefloquine in southeastern Mindanao Island, the Philippines.
      ).
      A sustained reduction in the total number of malaria cases can result in a heterogeneous pattern of malaria transmission localized to geographic foci, as in the Solomon Islands (
      • Harris I
      • Sharrock WW
      • Bain LM
      • Gray KA
      • Bobogare A
      • Boaz L
      • et al.
      A large proportion of asymptomatic Plasmodium infections with low and sub-microscopic parasite densities in the low transmission setting of Temotu Province, Solomon Islands: challenges for malaria diagnostics in an elimination setting.
      ). Microscopy conducted on peripheral blood samples from febrile individuals, which remains the operational standard for malaria diagnosis in the Philippines (
      Department of Health Philippines
      Chapter 4: Diagnosis and Treatment of Malaria, in Malaria Manual of Procedures.
      ), may not be sensitive in detecting these, and smaller foci with higher capacity for malaria transmission may occur at the household (hotspots) or individual (hotpops) level (
      • Bousema T
      • Griffin JT
      • Sauerwein RW
      • Smith DL
      • Churcher TS
      • Takken W
      • et al.
      Hitting hotspots: spatial targeting of malaria for control and elimination.
      ). In these malaria foci, infected people may be asymptomatic such that they harbour blood-stage Plasmodium without clinical signs of malaria and thus, will not actively seek diagnosis and treatment. These infectious reservoirs can remain hidden as microscopy and rapid immunochromatographic diagnostic tests (RDT) both fail to detect parasites at low density in peripheral blood (
      • Snounou G
      • Singh B.
      Nested PCR Analysis of Plasmodium Parasites.
      ,
      World Health Organization
      New Perspectives Malaria Diagnosis: Report of a Joint WHO/USAID Informal Consulation 25-27 October 1999.
      ). Some studies have already explored the usefulness of RDT in remote and low transmission settings of the Philippines (
      • Bell DR
      • Wilson DW
      • Martin LB
      False-positive results of a Plasmodium falciparum histidine-rich protein 2-detecting malaria rapid diagnostic test due to high sensitivity in a community with fluctuating low parasite density.
      ,
      • Fung AO
      • Damoiseaux R
      • Grundeen S
      • Panes JL
      • Horton DH
      • Judy JW
      • et al.
      Quantitative detection of PfHRP2 in saliva of malaria patients in the Philippines.
      ), but more sensitive methods may be required to support effective elimination.
      This study examined the epidemiology of malaria in three endemic provinces of Mindanao using RDT or microscopy as the primary parasite detection method, with later validation by PCR as the reference standard. The prevalence and distribution of circulating Plasmodium species were also determined. Genetic polymorphisms in pfmdr1, pfcrt, and pvmdr1 were identified, and the likely impact of these on malaria elimination in the region is discussed.

      2. Methods

      2.1 Study sites

      Three malaria endemic provinces in Mindanao, Philippines were selected for this study between 2010 and 2013. Each province is home to vulnerable indigenous communities and people displaced by local armed conflicts. There have been no previous studies on the genetic background of circulating malaria parasites in these provinces. All three provinces are regarded as experiencing a ‘type IV’ climate under the rainfall classification in use in the Philippines where a type IV climate is describe as having evenly distributed rainfall throughout the year.
      Sarangani Province stretches across a 230-km coastline of southeastern Mindanao between latitude 5° 33’ 41” to 6° 32’ 4” N and longitude 124° 21’ 39.6” to 125° 35’ 11” E (Figure 1A). The Sarangani Bay separates its four municipalities in the eastern part of the province from its three municipalities in the western part of the province. The population of Sarangani Province was estimated as 498 904 in 2010. It was described as experiencing ‘stable low’ malaria transmission with fewer than 100 malaria cases confirmed in 2010 (
      Philippines National Malaria Program
      Malaria Prevalence Data for Selected Provinces in Mindanao 2001-2012.
      ).
      Figure 1
      Figure 1Study site locations. (A) The coastal province of Sarangani and the inland province of South Cotabato where the cross-sectional surveys were conducted in selected municipalities per province in 2010 and 2013, respectively (inset: map of the Philippines). (B) Map showing the island municipalities of Tawi-Tawi Province where the cross-sectional surveys were conducted in 2012 (inset: map of Mindanao showing the location of Tawi-Tawi).
      South Cotabato Province is located at latitude 6° 15’ N and longitude 125° 00’ E in southern Mindanao (Figure 1A). It has 10 municipalities and a component city. Twenty-one (19%) of its villages are classified as geographically isolated and disadvantaged areas. There were 1.3 million people in South Cotabato in 2013. It was described as an area of ‘unstable malaria’, with no endogenous cases of malaria reported since 2010 (
      Philippines National Malaria Program
      Latest stratification of malaria endemic provinces in the Philippines.
      ).
      Tawi-Tawi Province is an archipelago located at latitude 5° 10’ N and longitude 125° 00’ E south of the main island of Mindanao. This province is among the five provinces composing the Autonomous Region in Muslim Mindanao (ARMM). It has 307 islands and islets grouped into the Tawi-Tawi island group, the Tawi-Tawi de Cagayan island group, and the Turtle Islands. This province shares sea borders with Sabah, Malaysia, and North Kalimantan, Indonesia (Figure 1B). It has been classified as having ‘stable high’ malaria with more than 1000 cases reported in 2013 (
      Philippines National Malaria Program
      Latest stratification of malaria endemic provinces in the Philippines.
      ).

      2.2 Study design

      This study was conducted in the municipalities of Kiamba, Maasim, and Glan in Sarangani Province in 2010, in the municipalities of Bongao, Languyan, Panglima Sugala, and Tandubas in Tawi-Tawi Province in 2012, and in the municipalities of T'Boli and Lake Sebu in South Cotabato Province in 2013. These municipalities were selected based on the recommendations of the Provincial Malaria Control Program in each province. This study estimated that a sample size of 263 participants was required per municipality to detect at least a malaria prevalence by PCR of 1% at 80% statistical power and 5% level of significance, assuming an average malaria prevalence by microscopy of 0.1% in the target population, and an approximate 10-fold higher prevalence by PCR.

      2.3 Data collection

      Local residents were invited to participate in the malaria survey through their rural health unit. People across all ages were gathered at a common place, usually the rural health centre. Participants who provided signed informed consent and who had been residents of the municipality for at least 6 months prior to the study were selected. Those who self-reported taking other medication were excluded to remove drug pressure aside from currently used antimalarial drugs. Information on age, sex, tribal affiliation, occupation, and habit of sleeping under a bed net were collected from participants. P. falciparum and P. vivax infections were diagnosed on site from finger-prick blood of participants by point-of-care (POC) tests. In Sarangani and South Cotabato, the RDT FalciVax (Zephyr Biochemicals, India) test was used following the manufacturer's instructions. This RDT detects P. falciparum histidine-rich protein 2 (HRP2) in blood and P. vivax-specific lactate dehydrogenase (PvLDH). The RDT kits were unavailable for surveys in Tawi-Tawi Province and microscopy diagnosis was used as the POC test. Two local expert microscopists independently examined the participants’ blood films for the presence of Plasmodium following national guidelines. Any person diagnosed with malaria based on parasite detection by the respective POC tests was referred to the Provincial Malaria Control Program for appropriate treatment following national guidelines. Finger-prick blood samples as a 6-mm spot on 3MM Whatman chromatography paper were collected from all participants for post hoc molecular detection of malaria parasites.

      2.4 Parasite detection by PCR

      Genomic DNA was extracted from an aliquot of each participant's original diagnostic blood sample collected on the filter paper, using the Chelex method as described previously (
      • Plowe CV
      • Djimde A
      • Bouare M
      • Doumbo O
      • Wellems TE.
      Pyrimethamine and proguanil resistance-conferring mutations in Plasmodium falciparum dihydrofolate reductase: polymerase chain reaction methods for surveillance in Africa.
      ). Parasite DNA was detected by nested PCR amplification of the 18S ribosomal RNA gene. Primers rPLU6 and rPLU5new were used in the genus-determining PCR, while the following primers were used in the species-determining PCR: rFAL 1 and rFAL 2 for P. falciparum detection, rVIV 1 and rVIV 2 for P. vivax detection, rMAL 1 and rMAL 2 for P. malariae detection (
      • Snounou G.
      Detection and identification of the four malaria parasite species infecting humans by PCR amplification.
      ,
      • Fançony C
      • Gamboa D
      • Sebastião Y
      • Hallett R
      • Sutherland C
      • Sousa-Figueiredo JC.
      Various pfcrt and pfmdr1 genotypes of Plasmodium falciparum cocirculate with P. malariae, P. ovale spp., and P. vivax in northern Angola.
      ), PadPo and rOVA2v for P. ovale spp. detection (
      • Padley D
      • Moody AH
      • Chiodini PL
      • Saldanha J.
      Use of a rapid, single-round, multiplex PCR to detect malarial parasites and identify the species present.
      ,
      • Calderaro A
      • Piccolo G
      • Perandin F
      • Gorrini C
      • Peruzzi S
      • Zuelli C
      • et al.
      Genetic polymorphisms influence Plasmodium ovale PCR detection accuracy.
      ), and Pmk8 and Pmkr9 for P. knowlesi detection (
      • Singh B
      • Kim Sung L
      • Matusop A
      • Radhakrishnan A
      • Shamsul SS
      • Cox-Singh J
      • et al.
      A large focus of naturally acquired Plasmodium knowlesi infections in human beings.
      ). PCR diagnosis was repeated twice for samples that were PCR-positive for any Plasmodium species.

      2.5 Genotyping pfcrt and pfmdr1 genes of Mindanao isolates

      Genomic DNA of samples previously confirmed as PCR-positive for P. falciparum was extracted from additional 6-mm blood spots using the Qiagen DNA mini kit (Qiagen, Germany). These samples were used for pfcrt and pfmdr1 genotyping. The primers used to amplify selected pfcrt polymorphic codons were designed from the P. falciparum 3D7 pfcrt gene (NCBI accession number NC_004328.3, Gene ID 2655199) (Table 1). P. falciparum 3D7, Dd2, and 7G8 were reference isolates (
      • Ponnudurai T
      • Leeuwenberg AD
      • Meuwissen JH.
      Chloroquine sensitivity of isolates of Plasmodium falciparum adapted to in vitro culture.
      ,
      • Foote SJ
      • Kyle DE
      • Martin RK
      • Oduola AM
      • Forsyth K
      • Kemp DJ
      • et al.
      Several alleles of the multidrug-resistance gene are closely linked to chloroquine resistance in Plasmodium falciparum.
      ,
      • Burkot TR
      • Williams JL
      • Schneider I.
      Identification of Plasmodium falciparum-infected mosquitoes by a double antibody enzyme-linked immunosorbent assay.
      ). The pfcrt amino acid haplotype CVMNKHALLAQN (codons 72–76, 97, 144, 148, 160, 220, 271, and 326) was taken as the wild type (
      • Gadalla NB
      • Malmberg M
      • Adam I
      • Oguike MC
      • Beshir K
      • Elzaki SE
      • et al.
      Alternatively spliced transcripts and novel pseudogenes of the Plasmodium falciparum resistance-associated locus pfcrt detected in East African malaria patients.
      ). Polymorphisms in the pfmdr1 gene were also examined as described previously, with the pfmdr1 amino acid haplotype NYSND at codons 86, 184, 1034, 1042, and 1246 as the reference wild type in this study (
      • Humphreys GS
      • Merinopoulos I
      • Ahmed J
      • Whitty CJ
      • Mutabingwa TK
      • Sutherland CJ
      • et al.
      Amodiaquine and artemether-lumefantrine select distinct alleles of the Plasmodium falciparum mdr1 gene in Tanzanian children treated for uncomplicated malaria.
      ,
      • Beshir K
      • Sutherland CJ
      • Merinopoulos I
      • Durrani N
      • Leslie T
      • Rowland M
      • et al.
      Amodiaquine resistance in Plasmodium falciparum malaria in Afghanistan is associated with the pfcrt SVMNT allele at codons 72 to 76.
      ).
      Table 1PCR primers, annealing temperature, and expected PCR product size for direct sequencing of polymorphisms in the pfcrt gene
      Primer
      Forward primer F, reverse primer R.
      Primer sequence (5′–3′)Annealing temp. (°C)Expected product size (bp)
      1. pfcrt codons 72–76, 97

      Primary amplification
      CRT1F1GGCTCACGTTTAGGTGGAGG55325
      CRT1R1GGTAGGTGGAATAGATTCTC
      Hemi-nested amplification
      In each case, the reverse primer in the primary PCR is used in the hemi-nested PCR.
      CRT1F2GTGGAGGTTCTTGTCTTGGTA55312
      2. pfcrt codons 144 and 160

      Primary amplification
      CRT2F1GACCTTTTTAGGAACGACACC56167
      CRT2R1AAAGCAGAAGAACATATTAATAGG
      Hemi-nested amplification
      In each case, the reverse primer in the primary PCR is used in the hemi-nested PCR.
      CRT2F2AGGAACGACACCGAAGCTTTA56158
      3. pfcrt codon 220

      Primary amplification
      CRT3F1CACTTATACAATTATCTCGGAGC55318
      CRT3R1AACTATTTCCCTTGTCATGTTTG
      Hemi-nested amplification
      In each case, the reverse primer in the primary PCR is used in the hemi-nested PCR.
      CRT3F2TCTCGGAGCAGTTATTATTGTTG55304
      4. pfcrt codons 326

      Primary amplification
      CRT4F1GTCTTGGTATGGCTAAGTTATGTG56285
      CRT4R1TATTTCCTCTTGTATGTATCAACG
      Hemi-nested amplification
      In each case, the reverse primer in the primary PCR is used in the hemi-nested PCR.
      CRT4R2GATTGTGACGGAGCATGGGTAA56259
      a Forward primer F, reverse primer R.
      b In each case, the reverse primer in the primary PCR is used in the hemi-nested PCR.

      2.6 Genotyping polymorphisms in the pvmdr1 gene

      P. vivax isolates from Mindanao were genotyped for polymorphisms in the pvmdr1 codons 91, 976, and 1076 by direct sequencing of PCR products. These were compared to reference P. vivax clinical isolates from French Guyana (MRL 14/450), India (MRL 12/985), Indonesia (MRL 12/1103), and the Solomon Islands (MRL 12/594) provided by the LSHTM Malaria Reference Laboratory. The primers given in Table 2 were designed for this study, based on the pvmdr1 gene of the chloroquine-sensitive P. vivax Sal-1 strain (NCBI accession numberAY68622; Gene ID 5473000).
      Table 2PCR primers and expected PCR product size for genotyping the pvmdr1 gene
      PrimerPrimer sequence (5′–3′)Annealing temp. (°C)Expected product size (bp)
      1. pvmdr1 codon 91

      Primary PCR
      P91_For1CCGTCAAGTCATAGGAAGCTGTT62195
      P91_Rev1GAAGCTCGAAATGAAGGACAGAAT
      Hemi-nested PCR
      In each case, the reverse primer in the primary PCR is used in the hemi-nested PCR.
      P91_For2TAGGAAGCTGTTGGGGGTGT62184
      2. pvmdr1 codon 976

      Primary PCT
      P976_For1GACCAGGATAGTCATGCCCCA60256
      P976_Rev1TGACTCGCTTCTTCTCTACATCC
      Hemi-nested PCR
      In each case, the reverse primer in the primary PCR is used in the hemi-nested PCR.
      P976F2ATGCCCCAGGATTGCTGTCAG60243
      3. pvmdr1 codon 1076

      Primary PCR
      P1076N1ACGGGCTGGAGGATTACTTCTG62241
      P1076R1TTCCCGGCGTAGCTTCCCG
      Hemi-nested PCR
      In each case, the reverse primer in the primary PCR is used in the hemi-nested PCR.
      P1076N2GGAGGATTACTTCTGCCACACTGAT62234
      a In each case, the reverse primer in the primary PCR is used in the hemi-nested PCR.

      2.7 Viewing and sequencing of PCR amplicons

      Amplification products were viewed by agarose gel electrophoresis. Direct sequencing in forward and reverse directions of pfmdr1, pfcrt, and pvmdr1 fragments was performed with the Big Dye Terminator v3.1 cycle sequencing kit (Applied Biosystems), fractionated in the ABI 3730 sequencer (Applied Biosystems). Sequence data were analysed using Geneious version 7.0 (Biomatters, New Zealand) and Chromas version 1.61 (Technelysium Pty Ltd., Australia), and aligned with appropriate sequences in publicly available databases.

      2.8 Data analyses

      Data were entered into Microsoft Excel (Microsoft Corp., USA) and checked for errors before importing into Stata version 12 (Stata Corp LP, College Station, TX, USA) for all statistical analyses. Proportions were compared using the Chi-square test, or Fisher's exact test when an expected value in the 2 × 2 tables was less than 5.

      2.9 Ethical approval

      The London School of Hygiene and Tropical Medicine Ethics Committee (Reference No. 5712) and the Philippines National Ethics Committee approved the conduct of this study. Adult participants provided prior written informed consent. Participants who could not read or write provided a thumbprint in the presence of an impartial literate adult witness. A parent or a guardian gave consent for children less than 18 years of age. Children who were 7 to less than 18 years of age also provided consent in addition to parental consent.

      3. Results

      Cross-sectional surveys were conducted in the three provinces where 2639 participants were enrolled (Table 3). Of these, a POC diagnostic test result was provided for 919 in Sarangani (RDT), 582 in South Cotabato (RDT), and 1088 in Tawi-Tawi (microscopy). The majority (84%) of these participants were indigenous people or ‘Lumads’ of Mindanao. Malaria prevalence by RDT was 1.2% in Sarangani and 4.5% in South Cotabato, where P. vivax predominated. None of the participants in Tawi-Tawi was diagnosed with malaria by microscopy (Table 3). Only one person was diagnosed with symptomatic P. falciparum malaria by RDT in Sarangani Province. This individual complained of feeling unwell, while the other nine participants with positive malaria RDT remained healthy during the survey and were considered asymptomatic. All were treated with standard antimalarial chemotherapy according to Government and World Health Organization guidelines.
      Table 3Characteristics of participants from Mindanao, Philippines
      Demographics
      Values are given as the percentage (number of positives/total number of respondents) unless indicated otherwise.
      SaranganiSouth CotabatoTawi-Tawi
      Participants (n)9506011088
      Age (years), median (IQR)
      Age data missing for 11, 109, and 4 persons, respectively, in the three provinces.
      19 (6–38)12 (7–30)23 (10–35)
      Participants <5 years old17.7% (166/939)8.3% (41/492)2.5% (23/1084)
      Female participants64.1% (602/939)67.7% (348/514)51.7% (560/1083)
      Bed net use98.1% (893/910)87.2% (422/484)87.0% (931/1070)
      Member of indigenous tribe89.4% (816/913)100% (519/519)83.9% (877/1045)
      Occupation of adults
      Farming21.9% (206/410)5.2% (85/165)16.2% (116/714)
      Housekeeping32.9% (135/410)30.3% (50/165)30.7% (219/714)
      Fishing2.8% (26/410)0.6% (1/165)9.2% (66/714)
      Others10.5% (43/410)17.6% (29/165)43.8% (313/714)
      P. falciparum prevalence
      Parasite prevalence estimated using the RDT FalciVax in Sarangani and South Cotabato, and microscopy in Tawi-Tawi.
      1.1% (10/919)0.2% (1/582)0.0% (0/1088)
      P. vivax prevalence
      Parasite prevalence estimated using the RDT FalciVax in Sarangani and South Cotabato, and microscopy in Tawi-Tawi.
      0.1% (1/919)4.0% (23/582)0.0% (0/1088)
      Mixed infection (Pf and Pv)
      Parasite prevalence estimated using the RDT FalciVax in Sarangani and South Cotabato, and microscopy in Tawi-Tawi.
      0.0% (0/919)0.3% (2/582)0.0% (0/1088)
      IQR, interquartile range (25th–75th percentile).
      a Values are given as the percentage (number of positives/total number of respondents) unless indicated otherwise.
      b Age data missing for 11, 109, and 4 persons, respectively, in the three provinces.
      c Parasite prevalence estimated using the RDT FalciVax in Sarangani and South Cotabato, and microscopy in Tawi-Tawi.
      Parasite prevalence by PCR was as follows in the three provinces: 3.8% (95% confidence interval (CI): 2.7–5.2%) in Sarangani Province, 10% (95% CI: 7.7–12.7%) in South Cotabato Province, and 4.2% (95% CI: 3.2–5.6%) in Tawi-Tawi Province. By PCR detection, P. falciparum and P. vivax infections were both present in all three provinces surveyed (Table 4). No P. knowlesi or P. ovale spp infections were identified. One symptomatic participant from South Cotabato Province was diagnosed with P. malariae by microscopy and this was later confirmed by PCR. This person had visited Sultan Kudarat, an adjacent malaria-endemic province, weeks before clinical signs of malaria were observed. Since P. malariae is uncommon in the Philippines and may be a misdiagnosed P. knowlesi infection, the participant's blood film was confirmed and the result validated in the provincial diagnostic laboratory in South Cotabato.
      Table 4Parasite detection by PCR in three provinces of Mindanao, Philippines
      ProvinceSpecies by PCR, % (n)
      P. falciparumP. vivaxP. malariaeMixed falciparum + vivaxCombined infections per province
      Sarangani

      (n = 950)
      2.0 (19)1.7 (16)00.1 (1)3.8 (36)
      South Cotabato

      (n = 601)
      3.2 (19)5.5 (33)

      0.2 (1)1.2 (7)10.0 (60)
      Tawi-Tawi

      (n = 1088)
      2.4 (26)1.8 (20)004.2 (46)
      Figures in parentheses represent the actual observed frequencies.
      There was no significant difference (P = 0.306, Fisher's exact test) in PCR-determined prevalence between P. falciparum and P. vivax infections in Sarangani Province. Similarly, there was no significant difference in the prevalence rates of P. falciparum and P. vivax infections in Tawi-Tawi Province (P = 1.0, Fisher's exact test). Meanwhile, the PCR-detected prevalence of P. vivax was significantly higher than that of P. falciparum (P = 0.047, Chi-square = 3.94) in South Cotabato (Table 4).

      3.1 Diagnostic performance of RDT and microscopy

      RDT and microscopy POC test results for diagnosing P. falciparum and P. vivax infections were compared with post hoc PCR results as the reference standard (Table 5). Inferior sensitivity of the RDT for the diagnosis of asymptomatic P. falciparum and P. vivax infections was observed in Sarangani Province and South Cotabato (Table 6). In both provinces, the specificity of the RDT for P. falciparum and P. vivax was acceptable. In Tawi-Tawi, microscopy failed to detect 26 samples that were PCR-positive for P. falciparum and 20 samples that were PCR-positive for P. vivax. The positive predictive value and positive likelihood ratio could not be calculated when comparing microscopy to PCR in diagnosing P. falciparum and P. vivax malaria in Tawi-Tawi, because no microscopy-positive individuals were identified (Table 6).
      Table 5Frequency of P. falciparum and P. vivax diagnosed by RDT and microscopy compared to PCR
      Values are actual counts of samples screened.
      ProvincePCRTotal
      RDTNegativePfPvPf and Pv
      SaranganiNegative87716141908
      Pf730010
      Pv00101
      Total88419151919
      South CotabatoNegative51212293556
      Pf10001
      Pv1162423
      Pf and Pv11002
      Total52519317582
      Microscopy
      Tawi-TawiNegative1042262001088
      Pf00000
      Pv00000
      Total1042262001088
      Pf, Plasmodium falciparum; Pv, Plasmodium vivax; RDT, rapid immunochromatographic diagnostic test.
      a Values are actual counts of samples screened.
      Table 6Diagnostic performance of RDT in Sarangani Province and South Cotabato Province and microscopy in Tawi-Tawi Province compared to PCR
      Sarangani ProvinceRDTSouth Cotabato ProvinceRDTTawi-Tawi ProvinceMicroscopy
      P. falciparum
      The diagnostic accuracy of point-of-care tests for P. falciparum was estimated after excluding those positive for P. vivax and vice versa.
      P. vivax
      The diagnostic accuracy of point-of-care tests for P. falciparum was estimated after excluding those positive for P. vivax and vice versa.
      P. falciparumP. vivaxP. falciparumP. vivax
      Sensitivity

      % (95% CI)
      15

      (3.2–37.9)
      6.2

      (0.2–30.2)
      6.2

      (0.2–30.2)
      15.4

      (5.9–30.5)
      0

      (0–13.2)
      0

      (0–16.8)
      Specificity

      % (95% CI)
      99.2

      (98.4–99.7)
      100

      (99.6–100)
      99.6

      (98.7–100)
      96.5

      (94.6–97.9)
      100

      (99.7–100)
      100

      (99.7–100)
      PPV

      % (95% CI)
      30

      (6.7–65.2)
      100

      (2.5–100)
      33.3

      (0.8–90.6)
      24

      (9.4–45.1)
      --
      NPV

      % (95% CI)
      98.1

      (97.0–98.9)
      98.3

      (97.3–99.1)
      97.3

      (95.6–98.5)
      94.1

      (91.8–95.9)
      97.6

      (96.5–98.4)
      98.2

      (97.2–98.9)
      LR (+)

      % (95% CI)
      19.24

      (5.36–69.06)
      -16.97

      (1.62–177.6)
      4.39

      (1.86–10.35)
      --
      LR (−)

      % (95% CI)
      0.86

      (0.71–1.03)
      0.94

      (0.83–1.06)
      0.94

      (0.83–1.07)
      0.88

      (0.77–1.00)
      1.0

      (1.0–1.0)
      1.0

      (1.0–1.0)
      RDT, rapid immunochromatographic diagnostic test; CI, confidence interval; PPV, positive predictive value; NPV, negative predictive value; LR, likelihood ratio.
      a The diagnostic accuracy of point-of-care tests for P. falciparum was estimated after excluding those positive for P. vivax and vice versa.

      3.2 Characterization of pfmdr1 alleles and haplotypes

      Sixty-seven out of the 71 P. falciparum isolates were sequenced for polymorphisms in the pfmdr1 gene. Two uncommon pfmdr1 alleles 86F (TTT) and 86C (TGT) with two nucleotide differences from the wild type base sequence (AAT) at pfmdr1 codon 86 were found in isolates from South Cotabato Province. Only the former has been described previously to our knowledge (
      • Beshir K
      • Sutherland CJ
      • Merinopoulos I
      • Durrani N
      • Leslie T
      • Rowland M
      • et al.
      Amodiaquine resistance in Plasmodium falciparum malaria in Afghanistan is associated with the pfcrt SVMNT allele at codons 72 to 76.
      ). Seven haplotypes at pfmdr1 codons 86, 184, 1034, 1042, and 1246 were constructed from 33 P. falciparum isolates with complete or near complete data. Examples of these haplotypes are shown in Table 7. The pfmdr1 codons 1042 and 1246 were invariant in the genotyped P. falciparum but these were included in the haplotype analysis for clarity. The frequencies of the pfmdr1 haplotypes were as follows: NYSND (18.2%), NFSND (21.2%), YFSND (24.2%), YYSND (24.2%), FYSND (6.1%), NYSNY (3%), and YYSNY (3%).
      Table 7Amino acid variants encoded by the pfmdr1 and pfcrt genes in seven isolates from Mindanao, Philippines, compared to previously published haplotypes
      SourceIsolatesPFMDR1PFCRTOrigin
      8618410341042124672747576144160220326
      Previous papers3D7NYSNDCMNKALANNL (
      • Padley D
      • Moody AH
      • Chiodini PL
      • Saldanha J.
      Use of a rapid, single-round, multiplex PCR to detect malarial parasites and identify the species present.
      )
      P2a
      Isolates with novel pfcrt alleles: Thr-144 and Tyr-160.
      YYSNDCNNTTYADPH (Chen et al. 2003
      P2b
      Isolates with novel pfcrt alleles: Thr-144 and Tyr-160.
      YYSNDSMNTTYADPH Chen et al. 2003
      E1a
      Southeast Asian allelic type described in the Philippines.
      NFCDDCIETALSSPH Chen et al. 2003
      This studyTGP 075NYSNYCMNKALANSar
      TT 489NF--DCMNKALASTT
      TGP 084YYSNDCIETALANSar
      TMJ 068YFSN-CIETALASSar
      TT 290NYSNDCIETALSSTT
      TMJ 080YYSNDSMNTALSDSar
      TMK 050NFSNDSMNTALANSar
      Amino acids different from the reference sequence (3D7) are shaded in grey. NL, Netherlands; PH, Philippines; Sar, Sarangani; TT, Tawi–Tawi.
      a Isolates with novel pfcrt alleles: Thr-144 and Tyr-160.
      b Southeast Asian allelic type described in the Philippines.

      3.3 Characterization of pfcrt alleles and haplotypes

      The pfcrt haplotype for codons 72–76 was constructed for 62 out of 67 P. falciparum isolates with complete data. The pfcrt wild type CVMNK was found in 27.4% (95% CI: 87.0–99.5%). The mutant haplotypes CVIET and S[AGT]VMNT were found in 59.7% (95% CI: 46.4–71.9%) and 9.7% (95% CI: 7.9–13.2%) of P. falciparum isolates, respectively. Two samples harboured a mixture of CVMNK and CVIET haplotypes. The SVMNT haplotype was absent among P. falciparum isolates from South Cotabato, while the CVMNK and CVIET haplotypes were present in the three provinces surveyed. None of the P. falciparum isolates in this study that carried the pfcrt K76T allele also encoded the pfcrt A144T and L160Y variants. Haplotypes for pfcrt codons 72–76, 144, 160, 220, and 326 in seven P. falciparum isolates from Mindanao with complete data are presented in Table 7.

      3.4 Polymorphisms in the pvmdr1 gene

      The pvmdr1 91N wild type allele was found in all 59 P. vivax isolates from Mindanao that were successfully genotyped out of 71 samples diagnosed by PCR. Nine P. vivax isolates were successfully genotyped at pvmdr1 codon 976. Four of these encoded the wild type Y allele, while five encoded the Y976F mutant allele. Three P. vivax isolates successfully genotyped at pvdmr1 codon 1076 all carried the F1076L mutant allele. The pvmdr1 haplotypes at codons 91, 976, and 1076 were constructed for three P. vivax isolates from Mindanao with complete data and four geographically diverse isolates from UK travellers that were sequenced in parallel (Table 8).
      Table 8PvMDR1 haplotypes from Mindanao, Philippines compared to haplotypes of P. vivax clinical isolates from other geographic origins
      IsolateOriginAlleles
      Alleles different from the wild type are shaded grey.
      919761076
      P. vivax Sal-1
      (Gene ID AY618622)El Salvador, Central AmericaNYF
      UK Traveller 01
      DNA from four P. vivax isolates taken in 2012 from UK travellers was provided by the Malaria Reference Laboratory (MRL) at LSHTM for pvmdr1 sequencing.
      French GuyanaNYF
      UK Traveller 02IndiaNYF
      UK Traveller 03IndonesiaNYL
      UK Traveller 04Solomon IslandsNFL
      TKE022Sarangani Province, PhilippinesNFL
      TKE065Sarangani Province, PhilippinesNFL
      TT531Tawi-Tawi Province, PhilippinesNFL
      a Alleles different from the wild type are shaded grey.
      b DNA from four P. vivax isolates taken in 2012 from UK travellers was provided by the Malaria Reference Laboratory (MRL) at LSHTM for pvmdr1 sequencing.

      4. Discussion

      There is general optimism that the Philippines can attain malaria elimination by 2030 as more provinces report a sustained reduction in malaria cases (

      The Global Health Group, Eliminating malaria in the Philippines, Allison Phillips, Editor. 2013; UCSF Global Health Sciences: San Francisco. p. 1-6.

      ). The provinces of Sarangani, South Cotabato, and Tawi-Tawi in Southern Mindanao were selected for this study because of insufficient data from these provinces to inform progress towards elimination. Against expectations, almost all participants diagnosed with P. falciparum and P. vivax infections either by RDT, microscopy, or PCR were asymptomatic during the survey; only two participants presented with fever. One participant in Sarangani Province was diagnosed with P. falciparum by RDT and PCR. The second, from South Cotabato, was diagnosed with P. malariae by microscopy and PCR. Those who carried malaria infections in these two provinces were members of indigenous tribes in geographically remote communities with poor access to health care. Thus, foci of malaria are still present in Sarangani and South Cotabato, with partial immunity in chronically infected individuals suppressing parasite density. Hence, an infectious reservoir is maintained in communities in the apparent absence of significant disease (
      • Harris I
      • Sharrock WW
      • Bain LM
      • Gray KA
      • Bobogare A
      • Boaz L
      • et al.
      A large proportion of asymptomatic Plasmodium infections with low and sub-microscopic parasite densities in the low transmission setting of Temotu Province, Solomon Islands: challenges for malaria diagnostics in an elimination setting.
      ,
      • Belizario VY
      • Saul A
      • Bustos MD
      • Lansang MA
      • Pasay CJ
      • Gatton M
      • et al.
      Field epidemiological studies on malaria in a low endemic area in the Philippines.
      ).
      There were disagreements between RDT and microscopy results and PCR. The low P. falciparum and P. vivax density in the sampled blood might have influenced the poor performance of the RDT in Sarangani and South Cotabato provinces. Participants who were RDT-positive but PCR-negative for P. falciparum might have carried persistent P. falciparum HRP2 antigen in their blood after detectable parasitaemia had been cleared (
      • Mayxay M
      • Pukrittayakamee S
      • Chotivanich K
      • Looareesuwan S
      • White NJ.
      Persistence of Plasmodium falciparum HRP-2 in successfully treated acute falciparum malaria.
      ). In Tawi-Tawi Province, none of the 46 participants who were PCR-positive for malaria were detected by microscopy. Since two expert microscopists independently examined the blood films, this suggested that either the blood films prepared in the field were not well preserved during shipment to the Municipality of Bongao in Tawi-Tawi for examination, or parasite density was below the level of detection of microscopy in all cases (
      • Harris I
      • Sharrock WW
      • Bain LM
      • Gray KA
      • Bobogare A
      • Boaz L
      • et al.
      A large proportion of asymptomatic Plasmodium infections with low and sub-microscopic parasite densities in the low transmission setting of Temotu Province, Solomon Islands: challenges for malaria diagnostics in an elimination setting.
      ,
      • Mosha JF
      • Sturrock HJ
      • Greenhouse B
      • Greenwood B
      • Sutherland CJ
      • Gadalla N
      Epidemiology of subpatent Plasmodium falciparum infection: implications for detection of hotspots with imperfect diagnostics.
      ).
      Based on national estimates, P. falciparum is more prevalent than P. vivax in Sarangani Province and Tawi-Tawi Province. However, there was no significant difference in the proportions of P. falciparum and P. vivax infections in our survey. South Cotabato has not reported a malaria case since 2010 and yet PCR identified 60 Plasmodium spp. infections among the 601 participants surveyed in 2013. This previously unknown burden includes a significantly higher proportion of P. vivax infections by PCR compared to P. falciparum. These findings suggest that subpatent infections of this species are prevalent in the provinces surveyed and so measures designed to control P. falciparum transmission may not be effective in reducing P. vivax (
      • Kaneko A
      • Chaves LF
      • Taleo G
      • Kalkoa M
      • Isozumi R
      • Wickremasinghe R
      • et al.
      Characteristic age distribution of Plasmodium vivax infections after malaria elimination on Aneityum Island, Vanuatu.
      ).
      This study is novel in characterizing the pfmdr1 and pfcrt genes of P. falciparum isolates from Mindanao for polymorphisms that might influence the effectiveness of AL (
      • Sisowath C
      • Petersen I
      • Veiga MI
      • Mårtensson A
      • Premji Z
      • Björkman A
      • Fidock DA
      • Gil JP.
      In vivo selection of Plasmodium falciparum parasites carrying the chloroquine-susceptible pfcrt K76 allele after treatment with artemether-lumefantrine in Africa.
      ,
      • Venkatesan M
      • Gadalla NB
      • Stepniewska K
      • Dahal P
      • Nsanzabana C
      • Moriera C
      • et al.
      Polymorphisms in Plasmodium falciparum chloroquine resistance transporter and multidrug resistance 1 genes: parasite risk factors that affect treatment outcomes for P. falciparum malaria after artemether-lumefantrine and artesunate-amodiaquine.
      ), which is currently used to treat P. falciparum in the Philippines. This was only partially successful, as attempts were limited by sample size, low parasite density, and the difficulty of amplification across introns in the pfcrt gene. Nevertheless, seven P. falciparum isolates from Mindanao were identified with the pfmdr1 NFSND haplotype, which has repeatedly been associated with prolonged parasite survival following AL treatment in Africa and Asia (
      • Humphreys GS
      • Merinopoulos I
      • Ahmed J
      • Whitty CJ
      • Mutabingwa TK
      • Sutherland CJ
      • et al.
      Amodiaquine and artemether-lumefantrine select distinct alleles of the Plasmodium falciparum mdr1 gene in Tanzanian children treated for uncomplicated malaria.
      ,
      • Henriques G
      • Hallett RL
      • Beshir KB
      • Gadalla NB
      • Johnson RE
      • Burrow R
      • et al.
      Directional selection at the pfmdr1, pfcrt, pfubp1, and pfap2mu Loci of Plasmodium falciparum in Kenyan children treated with ACT.
      ,
      • Lubis IND
      • Wijaya H
      • Lubis M
      • Lubis CP
      • Beshir KB
      • Staedke SG
      • et al.
      Recurrence of Plasmodium malariae and P. falciparum following treatment of uncomplicated malaria in North Sumatera with dihydroartemisinin-piperaquine or artemether-lumefantrine.
      ). This haplotype was found in asymptomatic infections in Mindanao and further studies are needed to evaluate its effect on AL treatment in clinical P. falciparum malaria in the Philippines.
      The pfcrt CVIET haplotype was dominant in all three provinces, suggestive of continuing pressure from CQ. This was widely used in the Philippines from the 1940s until AL replaced it for the treatment of P. falciparum infections in 2009, and remains recommended for P. vivax infections (
      Department of Health Philippines
      Chapter 4: Diagnosis and Treatment of Malaria, in Malaria Manual of Procedures.
      ). In the Philippines P. falciparum isolates with the pfcrt 76T allele were described previously as having compensatory A144T and L160Y mutations (
      • Chen N
      • Kyle DE
      • Pasay C
      • Fowler EV
      • Baker J
      • Peters JM
      • et al.
      pfcrt Allelic types with two novel amino acid mutations in chloroquine-resistant Plasmodium falciparum isolates from the Philippines.
      ), but these were not found in the present study. This suggests that (1) there might be other mutations in the pfcrt gene of isolates from Mindanao to compensate for the pfcrt 76T polymorphism, and/or (2) P. falciparum isolates from Sarangani, South Cotabato, and Tawi-Tawi experienced a different history of CQ pressure than did provinces where the Philippine-specific pfcrt A144T and L160Y mutations were reported. This is likely to have included widespread use of amodiaquine in the past, which selects for the SVMNT haplotype at codons 72–76 (
      • Beshir K
      • Sutherland CJ
      • Merinopoulos I
      • Durrani N
      • Leslie T
      • Rowland M
      • et al.
      Amodiaquine resistance in Plasmodium falciparum malaria in Afghanistan is associated with the pfcrt SVMNT allele at codons 72 to 76.
      ), but further studies will be required to explore this. Future studies should also examine genotype variation at the pfk13 locus, which had not yet emerged as a candidate marker for artemisinin susceptibility at the time of the laboratory work described here.
      There was limited success in characterizing the pvmdr1 gene among P. vivax isolates from Mindanao, mainly due to low P. vivax peripheral blood density among asymptomatic infected participants. The few results obtained showed that there were P. vivax isolates with the pvdmr1 Y976F mutation, suggested to be an important marker of P. vivax resistance to CQ elsewhere (
      • Suwanarusk R
      • Russell B
      • Chavchich M
      • Chalfein F
      • Kenangalem E
      • Kosaisavee V
      • et al.
      Chloroquine resistant Plasmodium vivax: in vitro characterisation and association with molecular polymorphisms.
      ). In addition, the pvmdr1 NFL haplotype identified here in three P. vivax isolates from Mindanao and one from a UK traveller to the Solomon Islands, has previously been reported in P. vivax from settings where CQ-resistant P. vivax is present, including the Solomon Islands (
      • Suwanarusk R
      • Russell B
      • Chavchich M
      • Chalfein F
      • Kenangalem E
      • Kosaisavee V
      • et al.
      Chloroquine resistant Plasmodium vivax: in vitro characterisation and association with molecular polymorphisms.
      ,
      • Tjitra E
      • Anstey NM
      • Sugiarto P
      • Warikar N
      • Kenangalem E
      • Karyana M
      • et al.
      Multidrug-resistant Plasmodium vivax associated with severe and fatal malaria: a prospective study in Papua, Indonesia.
      ,
      • Brega S
      • Meslin B
      • de Monbrison F
      • Severini C
      • Gradoni L
      • Udomsangpetch R
      • et al.
      Identification of the Plasmodium vivax mdr-like gene (pvmdr1) and analysis of single-nucleotide polymorphisms among isolates from different areas of endemicity.
      ).
      This work shows that P. falciparum and P. vivax isolates from Mindanao harbour gene variants that could influence the effectiveness of AL for P. falciparum and CQ for P. vivax malaria. Further studies are needed to explore the implications for the treatment of P. vivax malaria in the Philippines.

      Declaration of Competing Interest

      None.

      Author contributions

      MGD designed the study, supervised the field data collection, analysed the data, and wrote the manuscript. CD contributed to the study design, data collection, and analyses. JCD, JAB, FA, VM, DKB, SA, FY, WN, EB, and JB conducted the field surveys. MO was involved in the genotyping analysis. CJS and RH supervised the overall study design, laboratory procedures, data collection and analyses, and writing of the manuscript.

      Acknowledgements

      The Ford Foundation International Fellowships Program (New York, USA) and the University of the Philippines System Doctoral Studies Fund funded this study. The Philippine Council for Health Research and Development, the University of London Chadwick Trust, and the Environmental and Social Ecology of Human Infectious Diseases (ESEI)–Joint Research Council Catalyst Grant funded the fieldwork in the Philippines. The Provincial Health Offices of Sarangani, South Cotabato, and Tawi-Tawi assisted in the conduct of the field surveys.

      Funding

      The Ford Foundation International Fellowships Program (New York, USA) and the University of the Philippines System Doctoral Studies Fund funded this study. The Philippine Council for Health Research and Development, the University of London Chadwick Trust, and the Environmental and Social Ecology of Human Infectious Diseases (ESEI)-Joint Research Council Catalyst Grant funded the fieldwork in the Philippines.

      References

        • Espino F
        • Beltran M
        • Carisma B.
        Malaria control through municipalities in the Philippines: struggling with the mandate of decentralized health programme management.
        Int J Health Plann Manage. 2004; 19 (Suppl): S155-S166
        • Department of Health Philippines
        Malaria Medium Term Development Plan 2011-2016.
        National Malaria Control Program, Manila2011: 1-156
      1. The Global Health Group, Eliminating malaria in the Philippines, Allison Phillips, Editor. 2013; UCSF Global Health Sciences: San Francisco. p. 1-6.

        • Cortez GM.
        DoH targets a malaria-free PHL by 2030.
        BusinessWorld Publishing, 2019
        • Wen S
        • Harvard KE
        • Gueye CS
        • Canavati SE
        • Chancellor A
        • Ahmed BN
        • et al.
        Targeting populations at higher risk for malaria: a survey of national malaria elimination programmes in the Asia Pacific.
        Malar J. 2016; 15: 271
        • Chen N
        • Wilson DW
        • Pasay C
        • Bell D
        • Martin LB
        • Kyle D
        • Cheng Q.
        Origin and dissemination of chloroquine-resistant Plasmodium falciparum with mutant pfcrt alleles in the Philippines.
        Antimicrob Agents Chemother. 2005; 49: 2102-2105
        • Chen N
        • Kyle DE
        • Pasay C
        • Fowler EV
        • Baker J
        • Peters JM
        • et al.
        pfcrt Allelic types with two novel amino acid mutations in chloroquine-resistant Plasmodium falciparum isolates from the Philippines.
        Antimicrob Agents Chemother. 2003; 47: 3500-3505
        • Hatabu T
        • Kawazu S
        • Suzuki J
        • Valenzuela RF
        • Villacorte EA
        • Suzuki M
        • et al.
        In vitro susceptibility of Plasmodium falciparum isolates to chloroquine and mefloquine in southeastern Mindanao Island, the Philippines.
        Southeast Asian J Trop Med Public Health. 2003; 34: 546-551
        • Luchavez J
        • Espino F
        • Curameng P
        • Espina R
        • Bell D
        • Chiodini P
        • et al.
        Human Infections with Plasmodium knowlesi, the Philippines.
        Emerg Infect Dis. 2008; 14: 811-813
        • Fornace KM
        • Herman LS
        • Abidin TR
        • Chua TH
        • Daim S
        • Lorenzo PJ
        • et al.
        Exposure and infection to Plasmodium knowlesi in case study communities in Northern Sabah, Malaysia and Palawan, The Philippines.
        PLoS Negl Trop Dis. 2018; 12 (e0006432)
        • Harris I
        • Sharrock WW
        • Bain LM
        • Gray KA
        • Bobogare A
        • Boaz L
        • et al.
        A large proportion of asymptomatic Plasmodium infections with low and sub-microscopic parasite densities in the low transmission setting of Temotu Province, Solomon Islands: challenges for malaria diagnostics in an elimination setting.
        Malar J. 2010; 9: 254
        • Department of Health Philippines
        Chapter 4: Diagnosis and Treatment of Malaria, in Malaria Manual of Procedures.
        Republic of the Philippines Department of Health, Manila2010: 69-92
        • Bousema T
        • Griffin JT
        • Sauerwein RW
        • Smith DL
        • Churcher TS
        • Takken W
        • et al.
        Hitting hotspots: spatial targeting of malaria for control and elimination.
        PLoS Med. 2012; 9e1001165
        • Snounou G
        • Singh B.
        Nested PCR Analysis of Plasmodium Parasites.
        in: Doolan D.L. Malaria Methods and Protocols. Humana Press, Inc., New Jersey2002 (Editor189-)
        • World Health Organization
        New Perspectives Malaria Diagnosis: Report of a Joint WHO/USAID Informal Consulation 25-27 October 1999.
        World Health Organization, Geneva2000: 1-43
        • Bell DR
        • Wilson DW
        • Martin LB
        False-positive results of a Plasmodium falciparum histidine-rich protein 2-detecting malaria rapid diagnostic test due to high sensitivity in a community with fluctuating low parasite density.
        Am J Trop Med Hyg. 2005; 73: 199-203
        • Fung AO
        • Damoiseaux R
        • Grundeen S
        • Panes JL
        • Horton DH
        • Judy JW
        • et al.
        Quantitative detection of PfHRP2 in saliva of malaria patients in the Philippines.
        Malar J. 2012; 11: 175
        • Philippines National Malaria Program
        Malaria Prevalence Data for Selected Provinces in Mindanao 2001-2012.
        2013
        • Philippines National Malaria Program
        Latest stratification of malaria endemic provinces in the Philippines.
        2014: 1
        • Plowe CV
        • Djimde A
        • Bouare M
        • Doumbo O
        • Wellems TE.
        Pyrimethamine and proguanil resistance-conferring mutations in Plasmodium falciparum dihydrofolate reductase: polymerase chain reaction methods for surveillance in Africa.
        Am J Trop Med Hyg. 1995; 52: 565-568
        • Snounou G.
        Detection and identification of the four malaria parasite species infecting humans by PCR amplification.
        Methods Mol Biol. 1996; 50: 263-291
        • Fançony C
        • Gamboa D
        • Sebastião Y
        • Hallett R
        • Sutherland C
        • Sousa-Figueiredo JC.
        Various pfcrt and pfmdr1 genotypes of Plasmodium falciparum cocirculate with P. malariae, P. ovale spp., and P. vivax in northern Angola.
        Antimicrob Agents Chemother. 2012; 56: 5271-5277
        • Padley D
        • Moody AH
        • Chiodini PL
        • Saldanha J.
        Use of a rapid, single-round, multiplex PCR to detect malarial parasites and identify the species present.
        Ann Trop Med Parasitol. 2003; 97: 131-137
        • Calderaro A
        • Piccolo G
        • Perandin F
        • Gorrini C
        • Peruzzi S
        • Zuelli C
        • et al.
        Genetic polymorphisms influence Plasmodium ovale PCR detection accuracy.
        J Clin Microbiol. 2007; 45: 1624-1627
        • Singh B
        • Kim Sung L
        • Matusop A
        • Radhakrishnan A
        • Shamsul SS
        • Cox-Singh J
        • et al.
        A large focus of naturally acquired Plasmodium knowlesi infections in human beings.
        Lancet. 2004; 363: 1017-1024
        • Ponnudurai T
        • Leeuwenberg AD
        • Meuwissen JH.
        Chloroquine sensitivity of isolates of Plasmodium falciparum adapted to in vitro culture.
        Trop Geogr Med. 1981; 33: 50-54
        • Foote SJ
        • Kyle DE
        • Martin RK
        • Oduola AM
        • Forsyth K
        • Kemp DJ
        • et al.
        Several alleles of the multidrug-resistance gene are closely linked to chloroquine resistance in Plasmodium falciparum.
        Nature. 1990; 345: 255-258
        • Burkot TR
        • Williams JL
        • Schneider I.
        Identification of Plasmodium falciparum-infected mosquitoes by a double antibody enzyme-linked immunosorbent assay.
        Am J Trop Med Hyg. 1984; 33: 783-788
        • Gadalla NB
        • Malmberg M
        • Adam I
        • Oguike MC
        • Beshir K
        • Elzaki SE
        • et al.
        Alternatively spliced transcripts and novel pseudogenes of the Plasmodium falciparum resistance-associated locus pfcrt detected in East African malaria patients.
        J Antimicrob Chemother. 2015; 70: 116-123
        • Humphreys GS
        • Merinopoulos I
        • Ahmed J
        • Whitty CJ
        • Mutabingwa TK
        • Sutherland CJ
        • et al.
        Amodiaquine and artemether-lumefantrine select distinct alleles of the Plasmodium falciparum mdr1 gene in Tanzanian children treated for uncomplicated malaria.
        Antimicrob Agents Chemother. 2007; 51: 991-997
        • Beshir K
        • Sutherland CJ
        • Merinopoulos I
        • Durrani N
        • Leslie T
        • Rowland M
        • et al.
        Amodiaquine resistance in Plasmodium falciparum malaria in Afghanistan is associated with the pfcrt SVMNT allele at codons 72 to 76.
        Antimicrob Agents Chemother. 2010; 54: 3714-3716
        • Belizario VY
        • Saul A
        • Bustos MD
        • Lansang MA
        • Pasay CJ
        • Gatton M
        • et al.
        Field epidemiological studies on malaria in a low endemic area in the Philippines.
        Acta Trop. 1997; 63: 241-256
        • Mayxay M
        • Pukrittayakamee S
        • Chotivanich K
        • Looareesuwan S
        • White NJ.
        Persistence of Plasmodium falciparum HRP-2 in successfully treated acute falciparum malaria.
        Trans R Soc Trop Med Hyg. 2001; 95: 179-182
        • Mosha JF
        • Sturrock HJ
        • Greenhouse B
        • Greenwood B
        • Sutherland CJ
        • Gadalla N
        Epidemiology of subpatent Plasmodium falciparum infection: implications for detection of hotspots with imperfect diagnostics.
        Malar J. 2013; 12: 221
        • Kaneko A
        • Chaves LF
        • Taleo G
        • Kalkoa M
        • Isozumi R
        • Wickremasinghe R
        • et al.
        Characteristic age distribution of Plasmodium vivax infections after malaria elimination on Aneityum Island, Vanuatu.
        Infect Immun. 2014; 82: 243-252
        • Sisowath C
        • Petersen I
        • Veiga MI
        • Mårtensson A
        • Premji Z
        • Björkman A
        • Fidock DA
        • Gil JP.
        In vivo selection of Plasmodium falciparum parasites carrying the chloroquine-susceptible pfcrt K76 allele after treatment with artemether-lumefantrine in Africa.
        J Infect Dis. 2009; 199: 750-757
        • Venkatesan M
        • Gadalla NB
        • Stepniewska K
        • Dahal P
        • Nsanzabana C
        • Moriera C
        • et al.
        Polymorphisms in Plasmodium falciparum chloroquine resistance transporter and multidrug resistance 1 genes: parasite risk factors that affect treatment outcomes for P. falciparum malaria after artemether-lumefantrine and artesunate-amodiaquine.
        Am J Trop Med Hyg. 2014; 91: 833-843
        • Henriques G
        • Hallett RL
        • Beshir KB
        • Gadalla NB
        • Johnson RE
        • Burrow R
        • et al.
        Directional selection at the pfmdr1, pfcrt, pfubp1, and pfap2mu Loci of Plasmodium falciparum in Kenyan children treated with ACT.
        J Infect Dis. 2014; 210: 2001-2008
        • Lubis IND
        • Wijaya H
        • Lubis M
        • Lubis CP
        • Beshir KB
        • Staedke SG
        • et al.
        Recurrence of Plasmodium malariae and P. falciparum following treatment of uncomplicated malaria in North Sumatera with dihydroartemisinin-piperaquine or artemether-lumefantrine.
        Open Forum Infect Dis. 2020; 7 (ofaa116)
        • Suwanarusk R
        • Russell B
        • Chavchich M
        • Chalfein F
        • Kenangalem E
        • Kosaisavee V
        • et al.
        Chloroquine resistant Plasmodium vivax: in vitro characterisation and association with molecular polymorphisms.
        PLoS One. 2007; 2: e1089
        • Tjitra E
        • Anstey NM
        • Sugiarto P
        • Warikar N
        • Kenangalem E
        • Karyana M
        • et al.
        Multidrug-resistant Plasmodium vivax associated with severe and fatal malaria: a prospective study in Papua, Indonesia.
        PLoS Med. 2008; 5: e128
        • Brega S
        • Meslin B
        • de Monbrison F
        • Severini C
        • Gradoni L
        • Udomsangpetch R
        • et al.
        Identification of the Plasmodium vivax mdr-like gene (pvmdr1) and analysis of single-nucleotide polymorphisms among isolates from different areas of endemicity.
        J Infect Dis. 2005; 191: 272-277